Description :
From Genome Similarity Track
Location :
Scaffold_1897:119- 1302
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1897-fgenesh-gene-0.0Carbohydrate-binding protein

Sequence
1183 bases(100 bases per row)
TGCCCAGGCTACACCCAGGTCTACAGCGCCTTCACGGGCGTTCTCGAGCGCGCCGTGGCCTCGCTCGCCGACTCACTGGACGCCACGACGTTCACGACCA
CGGACGGGTACGCGAAGACGGTGTCCACGCGCAAGCTCTTTGGCGAGGCCGTGCGTCTCGACCACTTCCACGCCTACGAGGCGCCCCAGACGGCCGATCG
TCAGCTCAGCAGCGCCGCGGATGACCTGTCGCTGCCGCTCCACGAGGACGACGGCATGTTCATCGTCTTCCCGACACCGGCGTTCTACAAGGTCAAGGCC
GACAAGAGCCTCGAGGCCGTGACTGCCGGCGCGAGCGCCGCGGACTCGGGCCTCGTGATCGAGACCCACGACCATAAGCGCGTGCGCCCCGTGCTCAAAG
CCGACGAGGTGACCATCATGGTCGGCACGGGCTTCAACAAGTGGGTCAAGACCTCGGACCCCCTGCCGGCCGTGACCCACGGCATGCAGATGCCGACGAC
GGCCAACACGCCGCTGGCGGCCTCGGAGCGTCTGCTGCGCTCCTGGTTCGGCAAGATGACGTTGCTGCCGTCGTACCACCGCATGCTCTCGCACATGACG
TTCGAGCAGCACGCGAACGCCACGGCGCGCTTCCTGCGCCAGGACGCGGGCGTGGACGCGATGACTATCGGCTGCGCGCCGGGCCGCAAGCTCGTGGCGT
CCGCGACCCCGGAGTGCTCGTTCAAGGACTGCTCCACCAAGGCCGGTGCGGCGGCTCCGAGCGAGGGCTGCTCCGTGATCTGCAACCGCAACCACGACGG
CGACGATGCGCTCTGCGCCTCGAGCTGCAGCTGCTCCGCCAGCTCCCACCGTGCCACGACGTGCTGGATGCTCTGCGTCAAGGACCTCGACACGTGCGCC
ACGAACGACCAAGTGTGCTCCGGCCAGGCCCTGGTGTGCAAGGCGACTCCGGCACCGACCCCAGCTCCAACCACGAAGACGCCAACGACCCCGGCCCCGA
CCACCAAGACGCCAACGACGCCATCAAGCACTCCAGCTTCGACGACGCAGACGCCAGGCACCCCGTCATCGACGCCAGCCACGCCATCGACCCCAGGCTC
GACCCCTACGCCCTCGACGGTCTCGCCTTTGAGCCCAGGCACGCCCTCGACTGTGGCCCCATCGACGCCAGCGCCAACCGTTC