Description :
From Genome Similarity Track
Location :
Scaffold_74:118985- 126830
Transcript NameFunction/comments
Phyci_232702NADPH:adrenodoxin oxidoreductase putative
Phyci_232802kinesin-like protein
Phyci_232774kinesin-like protein
Phyci_82708Hypothetical protein
Phyci_164631conserved hypothetical protein

Sequence
7845 bases(100 bases per row)
GTACGTACCCCTGCGTCAGCGCCGCACACTTCCGAAATGGCGTCGGTGCTGCTGCTCCGCCGGCCGCTGCTAGCGCGCAAGGCGCCGCGCGCGCTGTCCG
GCGCCCTCGCCACCCGCGGCTTCGGCACCTCCGCCGATGCGGCGCCGCGCCGCGTGTGCGTGGTGGGCTCAGGCCCCGCGGGCTTCTACGCGACCAAGTA
CCTGCTGAAGGAGCACGGCGGCGCGCGCGTGGACATGCTGGAGGCGCTGCCCACGCCCTTCGGCCTCGTGCGCTCGGGCGTGGCGCCCGACCACCCGGAG
GTGAAGAGCGTCATGAACGACTTCGACAAGGTGGCGGCCGACGCGCGCTTCCGCTTCCTGGGCAACGTGCGCGTGGGCGCGGACGTGACGCTGGCCGAGC
TGCAGCGCCACTACCACGCCGTGGTGCTGGCCTACGGCGCCGCGGGGGACCGCGAGCTGGGCGTGCCGGGCGAGCGGCTGCGCGGCGTCCTGTCGGCGCG
CAGCTTCGTGAACTGGTACAACGGCCACCCGGCCTTCCGCGCCCTGGAGCTGGAGCTGCAGCGCGCCGAGACGGCCGTCGTCGTGGGCCAGGGCAACGTG
GCCGTGGACTGCGCGCGCATCCTGACCAAGGACGCGGACGAGCTGGCCACGACGGACATCGCCGCGCACGCCGTGGAGGTGCTGCGCCGCAGCGGCGTCA
AGAAGGTCTTGCTGCTCGGGCGGCGCGGCAGCGCGCAGGCCGCCTTCACCATGAAGGAGATCCGCGAGCTGACCAAGCTGGACGGCGTCGCGTGCGTCGT
GGACCCGGAGGACATGAGGCGCAGCTTGACGCCCGCGTCCGAGCAGGAGATCAAGGAGCAGCGCGCGCGCAAGCGCATGAACGACCTGCTCGCCAAGGCC
GCGGAGCAGTTCGAGAGCGCCACGGACGCCAAGCGCGTCGTGCAGATCAAGTTCTTGAGCTCACCTGCCGAGATTCTGGCGGATGAGAACGATCCCACGA
GAGTGGGCGCCATTCGTGTCGAGAAGACCAAGTTGGAGGGCGAACCCAACCAGCAGCGCGCTGTGGGGACCGGGGAGTTCGAGGACATCCCGTGTGACCT
CGTGCTACGCAGCATCGGATACAAGTCGCTGCCTATCGAGGCGGACGCACCTTTCGACAACCGACGCCACGTGGTGTCGAACGACCAAGGACGAGTTGTC
ACGACCTCAGAGAGTGGGGAGAAGCAGCCCGTGGTGGGCTTGTACTGTACTGGATGGGTGAAGCGTGGGCCCTTTGGTATTATCGGCACGAATATTGTGG
ACGCACGGGAAACGGTTAGCTGCATTGTTGAGGACTTTGCGGCAGGCAACTTCCTTCACAGTGAGGTAGGCGCTACGGAGGATTTGGGTGGTTTGGAGGC
TGTGGAGAAACTCATCAAAAAGCGTAACCCGGACAAGCAGCTGGTCAGATGGGCTGACTACGAGCGACTTAATGCTGAGGAAAACCGCCGCGGCGAACTC
GTTGGGAAGCCTCGTGAAAAGATCACATCCGTCGCGGAGATGCTGACCGTTGCGAAGAGTGCCAATTGATGATGTCTATCATAGCGGGGCAATTAGACCC
TTAGCCCGTTACGATAGAACAGCACTCAAGGCATGTCTTGTTGTCTTGTCGATGACAAAGCGTCATGGTACCTCAGCTTCTAGAGCCATTGCGCTCGTTT
TGGCGAGTAAGAGCAGCATTGGCGGCTTTCAGCGCGCGAGTTTTCTTGTGCTGCAGTATCATGGCAATTAAAAAATGCGTGTAAGCATCGTCTTCATCAT
ACTCAATCGTGGACATTTGGAGTGGCATACCTCTTCTTCCAGCAATCTCATCAGGCGTCGGCACTCCAGTGAGTCCTCACTGCTGTCGTCGTCGTGATTC
ACTACTAATGGAGGTCGAACTGCGTTGGGCCGACCGTCGAATGCAATGTTTTCGTTGTCGTCCACAGTGAATGGATCAATGAAGGGCTGGTTCACCCTGT
CTCGAAGAGCTGCTGCGTACGTAGGCTTTGTTCGTCGCACTGGGGCCGATAAGGGTCGCGCTGGTTTGATTCGATCCATTACGGATGGGATTGAAGCAGC
TGAGCGCGGGTGCTGCAAAGGAAGTCGAGCTGCTGCTGTCGCCATCTAATAACACCCGCACAGCAACGCGCCTGGTTAGACGTTTCCGCTAGTATCAACG
ATGTGCAATGACGTCTACAGTAGTCGGCCCATACAATGGCTTTCACGTGCCGCAGCTTGTTTGGGTCCGCCAGAATATTTTTTGGGAGTGCAAAGGTTCT
GGAGCAATATCGTCATGGTTAGATGGTTAGATGCACTGCACACGCCAAGGGAATGGATTCTCAGTTCCGTACCTTTGACTTGTATCGACAGCACTAACTA
GCCGCCCGACATACGTGTACAGCTCCAGGCAGTCCTCACGGATGTTCTAACCACACGAACAACGTTAAGTTTGCCAAGGCCACATGACGCTGTCAAATCA
CATACATCCATCGTCTCCGTCGTGGTCAGCTGCATCTGTTGTAGTTTCAGATTTGTTTCGTTGAGCTCGTCCGTCTTGTTTTTCAAGGACTGCTCATACT
GTTCGAACGCAGTTACTTCTTAGCAAAATACTTACAGTTGAGATAAAGGGTTTTCAACTAACCTGTTGTCGGATAAGAGCGACTTCATTCTCTTTTGACC
GCTGCACGGAGGCCACACGCTGACGTAGTTTCTGCGCACACAGGAATGATAAACCGAATAGGTGAGAGATATGTCAAGTTTTCACGAAGTAAAGCATGCA
CCACAAACCTGATCAAACTGCTTTTCATGATCTTTTGAGCTTCCGGTCGCGTCTACTGGGTTGATTGTTGAGGTTGAATACTGTTGGAAGGGATTCTGGT
TGCTTACTCCAACGTGCGTCTGGTTATTTCGGCTGAGAAGGTCCTGCATTTCTGCTCGATGCCGAGCGGCTTCCGATGCCAAAGCCCGCTCATACTCGCT
CGACTTTTGCTGTAAGCATCCTTCCAGCGAAGCAATCCTTCGCTTCTGCTCGTTAATGACTTGTCGGGCATTCTCCTTATCCTTCTTTGCTTCCGTCTAG
AAGGAGCAGAAGGATAGGGCGGTCTGTTAACGGAATAGCAGCACAAACAACCAAATGTTCGCATGGCTTACCACAACTACCGTAAAATTGCTTTTCGCGT
TGGCATACTTCTGTCGTAAGCGATCGCGATCAGACCTAGCGTTTTCAGCTATCATAACGCAAAGTGGTGACTAGGAGTGTTGCAGGTTTGTTTTCACGCA
CACGAATATACAAACGTACCGTCAGTTCTCAATAAACTTTGAACATGTCCTGTAGGCCCAACATGCCTACTCTTGAGGAATGCACTGGAGGCCGGGAGAT
GATCTCCTTGATCGTCATCGGCAAACACTGATTTCAGCACCAGCCCATCCTATGTGCACGGTACACAGTGAGTTTGAACCCCACCCTAACATAATTCACT
CAGAACGACATACCGCAAACTTGATCTCGCCGCTTTCTGAGATCTCTTCGGCCTGAAACCCGAGCTCGTTCAGTGTAGCGACAAACCTATTGTTGTACTC
GGCGCGCAATCCCTCCACCTGTCGACGCAAAATGCTGAGCTCTTCTTGAAGCTTACGAATGCGTCGGTCCTTGTCTGCAATGGTACCGTTGATATGATTC
ACGCGTGGCTGTTCACAGCATTCCTGTGTTAGTGATGATTGAGATGAACTTACACCTACAAGACTTGCCTGGTTCTGAACCGATCGACAACGGTTAGCAA
ATTGCAAGGTACCCAAGCATTCTTCGTAATGCTCTTTCATCGGGTGGATCGTTGCAATTAGTGTAGTAAAGCAATTTCCGCCTACGAACAACGAACGTTA
ACACTCTGAATAAGCTACCAATTCAGCAATTCTGGTCATCTACGAACCGATACTATTTTGCAGAAGACGCGTGAGTTTTGAGTCTCGGTACGGGATATAA
TTGTAGCCGCTCTCTGGATCCAATGACATCACTACTTTGCCAACTGCGCTCAAGCTTGAGTTAATGTGTAATGCCTCTTTGAGACGCTGACCATCAGATT
CGCTTTTCTTTAAGCGTTCAGACCTGATGCAGGCGAGGTAAGCACATTCGTGGCAACACTCGGTTGTTTTGCAAAACCAGCACGTACCCCGCGAGGTCAA
CCATGTTGAGCATCCCGTAGGTCACTTCCTCTGTGTCTCGAACTTCGACAATTCAACAAAGCCAGCATTAATTCAAATCAAGTTAACTCGCAGCGCTAGC
AGTCTGGACTTGCAGCAGTACCTTGTTGAAACACGTGGATAGTAAAAACAGTGTGCGATCGCGACGACACTGCGTTCATCTTGGTCTCGTGGGTAGATCT
AAGTTTCAGCCCGCATTGCACAATAGCATCCACTTCTTCCCTGGAAGCTACGGTAACCATGGACAAGTCCTTCACAAAGACTCTGCCTTGTGCATCTTCG
TGGATCTCAAAGTTTGCTAGATTAAGAAGCCCACAAACGGTCACAACGATTCGTAGTCCAAGCATCACAAGTTGTACTTTTGTACCTTTTTCATAATCGT
AGTCTTCCTCCGTTCGTGGCGGATTCGAGCTGAAGCTACATTCAAAGAACACACATCAAGCGGTGTGAGGGATGAAGCCGAGGTGTGACAAGTCTGTTAG
CCTCCGACGTACCTTACAGCACTCTCAGTTCGTGGAATCTGCTGTTGTTGCTACTCATTGAAATTCTCAAGATCAAATACAATACACTAATTTCTCACAC
CGGATGCGAATCGCCTACCTGACGAAGAAACCATTCAGCGCTACTTGACGTCTGATACGACACCGGCCGCCCTGTTTTCCTGAGGTAACTGTAATTTTGT
CAGTAGAAAGCAACATGGCGAAGAATTGAAGTAACCTGTAAGTTTTCTTTATGCAATACTTACGCTCGGGCAAGGTCACGAACTCTATCGCAGTAGATTT
CCAGAAAACTGACGACAAGGGTCACTTCCTATATCAACAAAACACGCTGTCAAGTTGAAACCCGTGCTCGGGTCTATGGTACTTAACGCACTTTGGATTT
GCTGGTCTGGCGGTTAACCATATCGAAGAGATACTCAATCGAACGCGAAAGCAGCCCTGCCTTGTCTCCACCGGGCTCGCCAAAAATGCTGTGCATGGAG
ATGCCAATTTGGTTATCTGTCTTGCTTACCACTACAGTGGAAGTGATAAAAACTCGGATCCAATGGTGTACCTGAATGTTTTACCGGAGCCCGTTTGTCC
GTAGGCGAAGCAGCAACTATTGATGCCCTTCAAGGCGTAGTCCACTAAACACTTACTCGTCTGATCACGCGTGACGACACAAAAAACGCATCAGTTTGAC
GATAGATATCATGCATATGCAGGAAGGTGACACCACACCGCTTCAAACAGGGTTTCTTGGGTTGTGTCTGTCCAGTATATCTATCACAGACACAATCCGG
TAAGGGTTGATACCACACAGAAGCATTACCATGACCTACATTGTCGAAGCTGAACGCGTGGTTTCCGTATTGCATTCGTTCTGTGTCCTAAATACCGTCA
AGCATGCACGTCAGTTCGGCTAACTACGAGACTGTCCAGCCAACCGTTAGTACCTTGATCACGATGTTGCTCGGAGTCTCTTTCTTGCGCTCAAACATGT
CTTCGGGGGCATTTTGGCCGTCAGCGCAAGGTCTAGCGCGAACATACACCTATAGTAACAATAAGATCGAAGCGAGTTAGACACATATATGGAGGCGGAA
GACAGCACCGACGGCTGTCTTTTTCTCATCAACCGAGGATCCGAGAGATAACCTTGACGTTTGCGTTGCCGAGCAACCGGGTGTAGTCTGTAGTGACCTT
ATGGTCCATGGTGAAAGCGTCTGCTCTTGGATCTCTTCGGCAGCCGCCTTCGCTGGAGTTCCGAGGAAGTATTTCCAGTAACGTTTCAAAAGAAGCGCGT
AGTTGCGCCTCTTCATTTCGCTGCTACGATGGGGCTTACCGATGTATCGAACAACTCAGTCGAGTACTTGCATCATGTGCTCGCGCACATCCAGAAGCTG
AGCACCCAAGCTTGTGGCGAGGGCAACGCCAGTAAGCACTTGCAAATTCGGGTCACGCACTGGCTTCGGAAGCTCCGCGGTCAGCCTACATCGAACCCAA
CGTGGTTGAAAAGCGTATTGGAATATGCCAACGTGCTGCTTCAAATGCTGCTGGAAGGCGTACGTATGGAAGCACTCTTGATGTTGCCGTGTCTGCACAA
TAATTGATGATGAGCCATTTCAGGTGATTGAGGAGCCTTTTACGAAAATGCCGCCCCAGGGCCCGCTGGCAGCCCTACCGAGGTATCAGGTGAGCCTACA
CATTTTTCGATGCGTAACTTGGTACCTAGTGACGTTCGGTCCACGCTCAGTCAGTTTGGTGGTTGTACGAGAGCAGGTTGCAAGGTTGGCAAAGGTAGCC
AGGCAATTCGTTCGCGGGTCGGCGGGTCAAGCGCGATCAACGCAGCACGCAGCAGCAAAAACTCGCCTTCGTGCTGCTCGCAATAGCTCCTACGAAGAGA
ATCAACGGGTCGTAGCTGTAACTCGCAAGGTGAGTAAACAGATACAGACTCAAGAGCAAGACGATCAGTGGGAGTGGCAGCGTGTTTGGAAGGGTGCATT
CGACAAAATGCACATGCAGCTACAGCAAAAGACGGAGGAGACTGAAGCACTCGCCACCGAGAACAAGGTGCGCTCTCTCATGTCACCGCCTACCAGTTTG
CTAGTCTTATTAATCAAGTTGTATATGTCTGCAGGAGTTGCAATCTGTCGTTGCAGGCTACAAGAAAGCTCTGGAGGAGGTTGAGCGGGCCCAACGAGAC
GTCGAGGCCAAGCACCTCGCAGAGATCGAAAATCTCCGAGCCGTGCACTCGTTGGAGCTATCGAACCTGCAGGCTAGACATCGGCAAAAACTCCAGGAAG
CGACACTGCAGAACGATGAAAAGCTGCTCAGCAGACGACGAGAAAGCCATTTCATCCGACCAGCAACAGCCACCACGGTGCGACTGCAGAGAATGTTTTT
ATTCTGGCCCTGGTCCTCTAACTATACTTTGTCTCGTTATACCAGCCGCAACAGGAGAATGCCACCGCCGACTTCCTGCAGTACATCGACGCTTTCTACT
CGTCCACACTGCACCTCACGGCCCAGAACAAGGCTTGACGAGCAAGCTACGTGGCACTTTTCAGTACCTCCGTCTCACTTGAATACAGTATATTTTTATA
CAAATTTCAAGATAAAGTAACGGACCCCGTCGAGACGGTATCATCATTGTGCGATAGAGACAAGAAGAGCAGCAGAGGAAGCGCATCATGTTGACCAAGA
CGTTGCAGGGAGATCCGCGCCGCCCCGGCGACCTGCACCCGTTCGTGCGCGAGCAGGTGGATCCTGACGAGGCCCCCGGCGACTGGTACGCCTTCTTCTC
GCTCGTGCTGGGCTTCCTCGCCTTTACCATGAAGGTGCGTCCTCCCCTGGTGCAGTGGTATCAATTCCTAGTATTTAGGGCCCACTAATGCTGAACCTCT
GTTGGTTGATGCTGTGTTTCACAGTGGAAGGAGCTGGCGTGGGGCTCGCTGCTGCTGTGCGTGGGCTCGTTCACCAACATGAAGTCGCAGGACATGAACA
CAACGCAGGTGGCCATGTCCTTCTTCTTCTCCACGAGCGCACTCGTGTCCGCCTACATGGGCACCATGCGTCCAGGCATGCCCATGCCCCCGTCGGCCCA
GTCAGTCCAAGCCCCGGCCCCGTAGACGGGAGCGGTGGAGAGAAT