Description :
From Genome Similarity Track
Location :
Scaffold_384:11898- 14262
Sequence
2364 bases(100 bases per row)
TCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGAT
TCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGT
CGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGG
AGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAAC
TCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTT
GCCCGAACGAAGTACGGATGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCCAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTG
CTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACT
TGAGAGTCTCCACTCACGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAACCCAGAGGTATCCCCAAACAGGATAGAGACC
ACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGCCCTTAAGGGGAATGCGCTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACG
AACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAACCTCCAAGAAGAGGT
CAGCCCCAGAGCTCTCCTCGGGAGGTCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGC
AGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCT
TCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGC
CTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCCGCAAGCGACGATTGCGAGTACTCGCTTCTTCATCGCCACCGGCTTTGGGAGTGCC
CTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGCTCCTGGGACTGTGATCACCGTGATCACTAGCGGACGACTGCACGCTGTCTTCTTTGTGCTCA
CTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCTG
CGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGC
CTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTC
TTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTTGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTAAAG
TGAGCCTCCGCCGCGCTCGCGCGGCCGAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACATCTCTTCATTCTGATTGGTCGGTAAACCG
AGCCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCACTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATAC
TCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATTAACCTCA
AACTTGACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCCCTCTTTAGTTAAAGAGGGGACCTGTGAACTGCCGTTCACT
GAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACA