Description :
From Genome Similarity Track
Location :
contig_1:118932- 120809
Transcript NameFunction/comments
g31.t1OWZ12961.1 Pectate lyase [Phytophthora megakarya

Sequence
1877 bases(100 bases per row)
TAGAGGTCAGGTCCAACACAAGGATGCTACAGTCTATTGCATCAAAAACGAACCGCACAAAGACACAAAGGTGAGCCACGGTCATCACGACGAAGTTATC
GCGATGTACGTCTTGAACGATGAGGCTGTTGGTATTGACTTAGTTGTTGAAACTGTACGACAGCGACTTTTGCACGGCTACGGTGCCTACAGAAAACAAA
ATACATGTACATCTACTGGTAGTGTGTATGCGATGCTTCTTCACTCTAGCGCATCGCCACCTTAGTTGAGCACGCCGATGCCGAAGTTGTTGGTGGTCTT
GCTGTGCTTCTTCGCCGCGCTCGGACTGTAGCTGGAGATGGCCGAGTACGACTTTGCCGTGGATAGAGCCGTCGCACCGTTGCGGGACTGAAACGCTCCG
CTGTTGTCTACCACGTTGGCGGCGCAGGAGCGACCGAGGTAGCTGTTGCACTCGGTGGTGGCGGTGGCGGCGTAGAGGGCGCCATCCGAGCCGGTCAGCA
GCGGCAGCGTCGTGTCCTGGAAGTAGTTGCCCTCGGCGAGCACCCATGCGTTGACGCCGATCTCGAACGAGTGGCCCGAGTTGTCCGCCCAGTAGTTGTT
GGCGATGTGCGCGACGACGTTGGCGCTGCTGTCGCCACCGATCTTGGGCGAGCGTCCCGATGTTGAATGAACGTAGTTGTTGAGCATGCTGAAGCGGGTG
TTCTTGCCGTAGAAGATGAAGGACCAGTAGTGGCGACCGTCACACGTAGCCGAGTAGTCCGTGCGGCCGTCGAAGTCCGAGTTGCTGATGGTCATCGTGG
ACACACTGGCGGCGTTCGTCGTCAAGAACTGACGGCCGACGTGGGAGACCTTGATGTGGTCCAGCCAGATCTTGTTCATGGCCGTCGAGCCGCCGTTGCT
GCCCTGCATGTAGAAGGCGTCGCCACCCCACACCAAGTGGCGGTTGAGCTCCGTGATGTGGATGTTTTGCACGATGATATTGTCGCCGTTCAGCCACAGA
CCCTTGCCCATGATGACACCGCTCGTGCCAATGCCGCGGATGGTCTTGCTGCCAGTCACCGTGAGTGGGGTGATGGCTGCGTTGTCGTACGTGACCGTCA
CGCTGGTGCCGTCCGAGCAGCCACCCGTGTTGGACATGCCACCGCTCTGCAGGATGACATCCTGGCTCTTGTAGCCATTGTTCTTGGCGATACACTCCCG
GGTGTAGTCTGGGCGGCAACCAGCTTCGGTCGTCGTGCCCTCCGTGCCGCGGAAGTCGAACGTCTTGTTGAGCACGATGACACGGGGCACGGCGTCCTTT
AGGTACGCGACGAGCTGCGCCGTCGTGGTGGGGTACACGGGGGTGGCGCTGCCTCCGCCTGTGGTTCCGGCAGCGAGACCGGTGGCCGATCCGACCGTGA
AGGCGTCCGTGGCCTGGACCACGATAGCCACCACCACAATGAGAATGGGACGGAAGAACTGCATTATCGCGAGTGTTTGGAGGTTCGTGAGCGGCGTGAA
GCAAATTGGGGAATGACATGCTGGTGGCGGTGGCAGACTGCGGAGCTTGTTGTAGTGTCCCGCTGTTAGAGAGGGTGCGGCTGCCCGAAGCGATCGTATC
GGCACGGGCGAGGACGCCCTGATCGGGTTGCACACGCGCTGGGTGCATCTATTGAGCTCGGATGATCCATCTGCTTTATCGTGGATGTCATGCGACTAGC
AAGACGGTATCCTGTTCGATTTCGCCATCTGCCACTCCGACATGGCGAAATGGAGAGACCAGGCGGCGGCGTGCTGATGCACCGCTCGATTGAAGTGAGC
GTAAAACTTGACGCCCCTAGGTGACCCCAACAAAAACACTATGGTTACAGCGGAGGGATATGCGGTTGGACCAGACA