Description :
From Genome Similarity Track
Location :
contig_78:118926- 120800
Sequence
1874 bases(100 bases per row)
TTGGGCGGGGGTGAGCTGGCATGGCAACACCGAGCTGGTCTTCCTGAAGGGGAAGCAGAACTCTGTCAAGTACACCGAGACGCTGACCTCCAGCAGCTTC
CTTGCCTTCGAGAACTGGGGTCAAAATTGGCAATTTGACCCCAATTTTCCAGCAGGATAACGCGTCCATACATGCCTCGAGGCTCACCAAGGGCTTCCTA
GCCACCCATAACATCGAAATGCTGCCGTGGCCTGCCAAGAGCCCCGATCTGACATCATAGAGAACGTGTGGGGGCTCCTGGCTCGCCGGGTGCAACGCCA
ACGGGCGCCAATTTGACAAGCCTGCCGACTTGATCAGACAGATCAAGTTGGAATGGTCTCGCATTGATCCTGCGTATGTTAAGAAGTTAGTGCGAAGCGT
CCCGAAGCGTCTAGAAGCGACGCGGCTGTTAAAAGGAGCCAAGACAGGTTACTAGAGCCGTTAGCATGTAGAGCCTCCAAGTGCGGCTATACTTCTGACC
CGACCTGAAACCAGATTTTGCCTCCTGGCTCCAAGCCATCTTGGTCTTTTTCAACTTCGCTTGCTGTATAAGTTTCTATTCCTTTACGACGGCCTCGGAG
CCCTCAGTTTGCAGGAAGTTCTCAGTTCCCGGCGCAAGAGCTCCGCTTGTCCGGTGCGGCTATAATTTCGGCGCGTACTGTATGAGGCTTGTAAGTTGTA
GACTCGTTCGCTATTCACGCACATTACTATATCACTTTGCTTGCAGTTATTCCCAAGATGGCCGGGCCAAGGTGTAGAAGGAAGATGAAAGGCCTGAACT
GCCAAACAGTTGTCGTGTTCGAGGTTTTTCAAACGAACACGAAAAACTGTTTTTCAGCTTCGGACGAAAGGTTTCTCGTAACCACAAACCAACATTTCGG
TTCGTTCTAGAGTAATTTGGATTGATACATATGTTATGCTTTCCAGATGAGCAACCAAGCGCGGCTGGCGCAATGGATAGCGTATCAGACTTCGAATCTG
GGGGTTGCGGGTTCGAGTCCCGCGTCGCGTACATTTTCTTTTTTGTCACGGCATCTGCACTGTTTCGACGAAGCCAGCAACAAAACTTTCATAGTTGTCG
TTTTAGTCACCGGGCAGAAGGCGTATGTACATGCATCTCAACGCAATTGCGCGATGTGAAGCCTGTATATACACGGGAGATATCAACGATCGCCCTCCTG
CGAAGTGCCCTCCCATAGAATAGGCGCGATCCCGCGACTAAATATGGTAAAGGGTAAAACGAACCGAAGCACACAGCGTCACGGCGAAGGCAGAGACGGA
GCCGAAAGCGTGAGGGCAATACGTGAGACAGAAGGTTCTATCTCCATATCGCGAGCGAAGCGCGGCTGATTCACTATATATTCTTCCTTTTATGTATGAG
GTCCCCCGTCCATTTCCCTCATAGATAGTGTTTTGTAGTCTTGGCAGGCTCGTTTCCGCTTTCTCGAGTTGTTCGCGATGAGACAGGAGCGTTCGTGTAC
ACTGGCTGACCCGACACAATGGCCTCCAACTGCGCACGAGTTGTCTGTGCGTCTCCACTTCAACAGCTTAGAAACCTATTTTGCAATGTTACAGAGTTTT
CGGTGGCACTCGACTCTTAACGCTGCACAATCTGTCTTGTCTCGACGCCACAGTGCGTTTCGCTTTGAACGGAAGCATGATAAACTTTCATCTGCCGGCT
CACCCCTGCACGGCCCTCATGCATACCGAGAAGTCGGAGGCTTACTTTTTGTAGGGAAGGGCCGGAAAGCGACCACGCAACATACAACACAGCAACACAA
AACTTGTTTGCGAACAGCGTATGTGACGGCAGAACCATGCATTATAGCACGGACCGTGCAGCATAGATTCAAAG