Description :
From Genome Similarity Track
Location :
Scaffold_29:118906- 121531
Transcript NameFunction/comments
g7686.t1XP_009846791.1 hypothetical protein H257_19342 [Aphanomyces astaci
g7687.t1hypothetical protein

Sequence
2625 bases(100 bases per row)
CAATGGCCACTACCGAAGGAGCAAGTCGATGTGATCGACGCATTCTTCGCGGCGAAATATGCCGCGGGCATGGTGCGCGAGTCAAATTCGCCGCACTCGT
CCCCGACATTTTGCGTGCGTAAACTCAATGGGAAGTGGCGTATGGTACATGCGTTCAACAAGTTGAATGCAGCAACCATCCCGGCGTCCACGCCAATCCC
TCGCAAGGACGTGTTACAGAACAACATGGCGGGCTGCACCATCTTCAGTGCACTCGACATGGTCGATGGCTACTATCAGCTGCTGATGCGGGAATCAGAC
GTCCCGCTCACAGCGGTGAGCACACCCAGCGGGATGCTGTGGGAATGGCTCGTGATGCCCCAGGGGCTGTCGAACGCACCAGCCACGTTCAATTGACTGG
TGACTCAACTCTTCCGGCCGATGCGGCAGTTCGTACAGACGTACTTTGATGATATCTTCGTGCACAGTCGTGCCTCAGGAGGTGAGACGGCTGTCGAAGT
GCACGTTAACCACCTCCGTGAGGTATTGATGTGCATGCGCGATAATCGCTTGTATGCGAACATCAACAAGTGTATCTTCGGAGCCGAAGAGATTCCCTTC
TTGGGATGTTTCCTTGGCAAGGATAGTGTCCGTGCGGACCCTGAGAAGATATGCGCGATCGCACAATGGCCAGTGCCAGTATCTCAGAAGGACTTGCGCA
AGTGGCTTGGCCTTGGCAACTACTTACACAAGTACAGCGCCAACTACGCTGATATGGCACGGCCACTGATGAACCTTTTGAAGAAGGAGGCGGAAGGGTC
GTGGGACGATTAAGGACGGCAGGCTTTCGAGGCAATCAAAAGAAGCCTACAGAGCGCTCCGATTTTGGCTGTGCCCGACGATGATCGTCCCTTCAGTGTG
GTATGCGACGCATCCGACTTCGCCATAGGCTGTGCCCTGCTGCAGGTCGATGCCGAAGGCAGAGAACGGGTAGTATCTTTCCAGTCGCGCCAACTCAGGG
CGGCTGAAAAGAACTACCATGTCCATGACAAGGAGCTTCTGGCGATGAAGTACGCACTCGTAAAGTTTCGGGTACACCTGCTAGGCAGCAAACCCTTTGT
GATCTACACAGATCATGCGTCCTTGCGGACAGCGACGTCGTCACCCCACCTCTCCCAGCGTATGGCGAGGTGGCTCTCCTTCTTTGCGGAGTATAACTTC
ACGGTGGAGTACAAACCAGGGAAGCAGAACGTTCTCGCGGACGCGTTGTCCCGGCGTCCGGACTATGAGCTGGCGCACGTTGCGTATCTCGAGTCTCCAC
TCTATGAGCTGCTACGCGAGGCGTACGCAGAAGATGGCGATCTCGCAGACCTCGTAACTTCACTGAAGGTGCCTGAAAAGGCTGTGAAACTCACTACTCG
GCAGCGCTCACGGTTGCACCGCTACTCACTAGCAGATGGTCTCCTCTACTATCAGGTAACCCCGTATCGTGGTTCCCAACGACGTGAACTTACGTCATCG
AGTCCTTTACGAGGCACACGACACGCCGCTCAGCGGTCATCTTGGCCGAGAGAAGACGTATACGTCTGTGGCGCGCAACTTCTGGTGGCCACATATGTAT
AAGTGGGTGCGCACGTACGTACAGACGTGTGAGACGTGCCAACGCGTGAAGCCCGCCCCATCGTCGTCGGCTCCATTGATGAGCTTGCCGGTGCCGGCTG
ACTGTTGGCGCTCGGTGAGCATGGATTTCATCTTTGAGCTTCCGGCGGACACGCGCGGCCACACTGGCATCTTTGTCTTCGTCTGCCGACTGACCAAGAT
GGTGCGGCTTGTCGCGGTAAAGAAGAGCGTGACGGCGCCGCAAGCGGCACAGCTCTTTGTCGATAATGTCTTTCGACACCATGGCCTCCCGGAGGCGTTC
GTGAGTGATCGAGATCCGCGCTTTGTGTCACACTTTTGGACACACTTGTTCCGTCTTCTCGGTACGAGATTGGACATGTCCACAGCGGACCATCCACAGA
CCGATGGTCAGACGGAGCGCGTGAACCGTGTGTTGGAAGACGTACTGCGCAGCGTCTGCGCTGAAGAACCCACCAAGTGGAGCACGCTGCTACCCCAAGT
GGAGTTTGCGCTGAATAATGCTGTGCATTCGTCGACGGGTTTCACCCCATTTTACGTAAATGGCTTGCGGCATCCGCGTACACCGCTATCGTTGCCACCG
TCTTCGAGTTTGGGTGGGAGAGAGGCTATCGCCGAAGATCCGCGTGGCCTTCAAGGCCTCCGTTCGTCCGTCAAACGGAACCTCCTCACGTTCATCGAGA
CAAGTGAAGAACTACGACAGCGCGTCCGGGACGCTATGGCGGCTGCTCAAGACACGCAAAAAGAACACAGTGACAGGCAAGGGCGTAAGAACACGCACTT
GTTTAAACTTGGGGACCAGGTCCTCTAAAACACTAAGAATCATCCTATCCAGGCAGTCACTGCGGTGGGCAGCACCAAGCTTCAGCCACGATTCGTGGGG
CCGTTCACGGTCATTGGGGTCCACGGCAACGCGTACACGCTGGACCTGCCATCGGCCATGGCCACGCATCCAACGTTCTACGTGGGCTTGCTCAAGCCTT
ATCGCCCGGCTGAGGCAGATGACTC