Description :
From Genome Similarity Track
Location :
scaffold_197:1189- 3312
Sequence
2123 bases(100 bases per row)
ATTAATGTAAAATGGCTTGAAGCCAGTGATACATGGACTGCATTGTTGATGGCAAATTCGGCAATCGGAAGCATATCACTCCATGTCGTCGGTGACGATG
CACAAAAACTGCGTAGAATGTCTTTTAAAACGCGATTCGTGCATTCAGTTTGATACCGGTCTCGAGATGATATTTTGTGGTCATCTTTAGGCGATGCCAG
ATAGACGCAATGAGCTCGTCCAAAAGTCCGCTATAAAGCGCGTATCACGATCGAATAATTCATGATGTCGAAAGGCATGAGCGACAAATAATCGAGCGCT
CTGCTCCCAGTAACAAAACCAACCGTTGGTGCGGGGTGCGTTGTCCTGCTTAATCAgtctacaaagaccaaaAACCATTATGCCCTGCGGCATCAGGGGG
TAACTCATAGAAGATATCCAAACTGACGGACCGCTAGCAATCTGCTGGTACTGACAGACTCTGCAATGGAGCCTGACTATGTGGGGAGAGCTTGACATAC
GTCACACGAGCTGTTAACCCAAGCATATATTTTGGGCCATCAAATGTGGTGTGCAAGCGCTGCATAAGTCTTTTCTCGACCGACAAGACCTGCGATAGGC
GTATCTTGTGCGTCATACGCCAACTTGTGCTTCAAGTTTTCGTTGTCGGGTACGACGACCCGAGAGTCATCTGTATCATATACATGGTGGTAAAATAACC
GTCTTCAAGGGAGTATCGATGTAATCGACCGCAAACTCGCGGTGATCATAACAACAAGACCACACTATCCTTAGCGGTTTACCACTTAAAGATTTCAGCA
CACACTAGGTCGTTTGGATACATTTGTCGTATCATATCGAACACGCTGGAAGCAGCTTGCGAACTCACAGATAATTTGTAATCGGGACGCCGAGAAACGG
CATCCGCCAATATATTCAATTTGCTTGGCTTGTAAAGttgaattttgcaaagaacgtcaaTCAATGGGTCATCCCTTGTGACAAATGTGGCGTTTGCGTC
ACTGTATGCAACCATGCATGGTCGATATAAATGACGAATGGTTTAGAATCAAAGAGGTGAGCACTAAACTTCACCAAATCATATTTCATTGCTAACAGTT
CCTTATCGTAAAGGGGGTAATTACGTTCAGCTACCTTCAGCTGCCTCATATCCATTGACATTTTGCTGCAGCAACGCCGCAAAGTTAAATTCGTCGCGCG
CAACACTCTATGGTAAATCGTCATTTGGTAATGCCAAAATAGGCGCTGCCTGCAAGCTGAGCTTCATATCGTCGAAGGCGACTGCACAATCATTTGTCCA
TAACTACTCTTTGTCTTGCCTTTACAAGTCCAATAACAGGCATGCCATATCGTCATGATTCGTGGTATACCGGTGGAGATAGCTAACCAAGCTTGACCAT
TTCTTCAGATCCTTCTGGTTGTCGGCTATCCTGAGATCGCTTTGATCTTCCTTGTGTCTACCCGAACATCGTGGACGCCGACAAAACAGCCCAAAACTGG
TACTTGTATGACACCGAATATACATTTATTAATGTTGGCAAAGAGCTGATGCTTTGCCATACACGCCAATACCTGTTACAGGTgcccaaaatattttttt
cgatagaacggcgtgtttCGGATTTCGACTGGACAAAAATACCGTCGAAGTACGTCGACGTGAACGATCGCAACGGACGGAATAAGTGCGTAACGAAACA
GGGAAACGTCGCTGGCACATTGGAGAGTCgttgtggcatcacaagGCAATCCCACAACATACCGCTAGGTGTACTCACTGCCATTGGAGGATCCATTAAA
ATTTGTTAGCGATCATCAGCTATGCCTAGTACGCTAAAGTGTTTTGAGCCAGTCATCTGGTCGATGGTGGCATCCTTGCGAGGAATAGGGGTATGTACTG
ATACAGTTTTGACGTACAGCTTGTCGTACACGTGTacaattcgccacttgccattgGGTTTGCAAACGCAAAATGTCGGCGCGCTGTGGGGAGATTTACT
CTATCTCACCCACCCCTGTTGCTGTTTTGCAGCAAAGAACAAGACTCTGAACTCGGATTGCTCAGCTGGCAATGGACATTGACACATATCTTGCACCTGG
CTTGATCTCTTGATCTCGTGTCG