Description :
From Genome Similarity Track
Location :
Scaffold_2923:1189- 2363
Sequence
1174 bases(100 bases per row)
ATGCGAGGTACTCCCTCTGCCATGGATAACAGCTGTTCGTAGCGCTTATACGGGATGTGGCCGAGACGGGCGTGCACAACAGCCCATGGCTCCTTACGAG
ATGACGTCGCAACAGCAGAGTACCTCGGCTTGCTGAGTGCATCACATGGGGTGAAGGTAACGCACCTTTATGCGAAGGATGGCTCTCAAGGACAGAAAGT
CACTGCTGGTAAGTTTTCACCCAATCCTACTAGCCGTTTGGCTGCTGATGGAGATGGTGCTTCTGAAAGACGATCTTCGTTCTAGACGGTGGCGCGTGCA
CTGCAGTTAGTTCCAgcgctgttgcagctgtggagatggagctccAATAGATATGGGAGAATGCTCGTGGGGCTACATGATGCGCACGGGGAACCGCTTA
ACCATGTCTTCAACTCTGGCAGAGTGGGGGGTGGGGTGGGGTGGCTCCACCAGATTTATGATTGGCTCCCCGATTGGCCTTTCTTCCCAAATTTGAGATT
TGCTCCGACCAAAATGCTTCGGGAATTACTTCAGTTTAGCCAAATGAGAAATTGTCAACTCACATGTATTGTGCTGTGCAGGTGTTTTGCCGACTGTTTT
AGAGCTCTAAAAAGGAAAGCTCTATTTCTAAATGTGTGTCTTAAAAAATCCATACCGTTGGCTAAATCGGCCATTTTTGGAAGAAAGTGCTTACGTGGAC
CAATTTTTCATTACCCTTGCCGAGTCTACCACCTTGCAGCTATCGTAGTGTGTGTGAAAGGGAGGCTACCTCCTTCCGTGCACGCTACCCGTAGTTACAG
TTACCGGTAGGCACGTGGCAACTTGATCGAACAGCAGATGGTTGAATGCACTGTACAAAAGTACCTCGTAAATCATGCGGCATGATAGATACTTCGtcta
cagtacatgtatcataCTTGTAGCTGAGCCTCCGGCATTGCTACCCATCGCTGTTCACGTCTGGGTATTGTTTCTTTAATCGTTctcgccagcacgtcgt
ccatgTGGTGGCCCAAATTGCACTGTTTGAGGATACTTGCGAAACCTGCTGTTtttttggtttgttaagcggccttctatttgagttttatgtcactatc
ttgtagaagccttttaggcagtctgaaagatctgcccgtattcctcgaagctttcacctcggtcttttccttcg