Description :
From Genome Similarity Track
Location :
Scaffold_3:118855- 122026
Sequence
3171 bases(100 bases per row)
CCAATTGGGCGATAAAAACTTCATCGCTTTTACTCAGGTGAAAAAATGATGTCTCCTTTTGTTACTCCTGGCTCAGTAGATACGAGTCGCAAGTCATCTC
GCAGCGTCAAACAGTCGAAATCCCTCTCGCTTTATATCAGGTGGCCATCTGATGAGCGACTTGGATCTTTTGAAAGCGAGTGGATATACTACAAGTGAGT
AAGACGGTCCAATTGTTGCTCGGTCGTTAGTATGACAGCACAAGGACCATTTTGTTACGCTACCAAGGTGTGAAGCAATCTGCCGGAGTCTGTTTAGCAA
CACAGGCAGGCGAAAGCCTTCAGTTCCAAGCCGGGTTTACATGAACATGGATTCGTGAAAAAAGCAGCATCTGAGTAAAAATCGATCAATTACCCCAGAA
GGGACGATACGATCATCTTCTATCGACTGGATCGTAAATAGTCAAGGATATTGAGGGAATGATTCCATGTTGTGTAACTACTGAGGGAGTACATCCCAGC
ACATACTCAATACATTGAGTGGAGAAAGTGGATTGAGCTTAGACCGATACGCTTGATCTGATTACGCCTTCGAAGCTAACTTTATTCAGATCACTTAATC
TCCAACGCTTGACCAACAAATATTGCGCGATCTATGTACTCGTCTCTGAAGACGAAAAAAGTACTATATCTGAGACCTCTGCAGTTCATCTATGTAAGAA
AGTTTTTCTCAACAAGAGGAATCGGACGACCGATACAAAGCTCAATATTATGGACTCGCCCAAAAACTTTATCTTAACGATATTTTGAAATTTAAAGTAT
GGTTTTATGATAGAGTACCGTGCTAATTGCCTAAAAATGAAGGTACCCTCGCGAGATCGACCTATAATCCAGGCTCTAAGTACTTTGTCTTGATGCAGTT
GCCACTTATTCTCAAGCTTGTCGTGGCTATCAACAAATCCCTTGCCGGTCACGTAGCAGAGGATCATTATAAGGAATCAACTACCCTTCATACAGTACGA
TCGGAAACAATAAGACGGATAATTGTTCGCTAAATATTTTACTCAAAACAAATACCGCTAGTCTAACAATTTATAACAACACAATGATCGAAGTTGATTT
TTATGTGCTCAAAAATTAGTATCGTTTTTAGACAAAGCAATCGAGGAAAGTATTCGCGCGCTGCAGGTCAAGCGGATTATAATAGGATAGGTATACGTAC
TTGCCGCTGAAGTGCAAAGTACTAGCTGACTGATTGTATTATGTGCCTTTGTGTGCTATCAATTATTTATATACAGGTTAAGGCGTAATTGCGAGATATC
TGTGATGTCTTTTAGATTGGAAGAGGTGGATTTCCTACGGAACTCGAACGCGGTCAATTCTTCTATACAAAAATAGCAAGTAACTCTTAGCGATACAGCA
AGACTAATTTTGCGCTCCCTTCCGCCTACAGACCGCAGAAAACCCCTGTAAGACTAACAATTAAGGCCCAGAAGCAAATGGTGCAGGAGGCTTCCAAGAC
TCGTAACAGCGCCAGAATGCTTGATAGCGCTCCGCAGCTATCTTTGTAGATGCGAATAGTGCAAGGGGTGCTGGAAGATGCATCAAAATTGCGCTGCGAG
AAGAGAACAGGTCTATTAATCCTCTTGCACCAACATTGAAAAGATCGTCTCAACTGGATAGCTGAGGAGAGGCTTATGGCAACAAGTGAAGCTTTGTGAT
ATATAATTTTCGGATGTGAAGAAATTTAATCTGCGTGGACCGGATGGATTTTAGTACTATGTGCGTGATCTGCGTCGATAAAACAGTCTTTTACACCGAC
AGTATTGAGGCATGATGTTGTGCGGTGCTTTTAGTGTTAGATGAAATTCCATAATAGCAATAATGAAGGGCAAGCAGAATGCAACAAGTTCCATCAACAC
GATCCATAGCGACTTCTAATTTCTATTTACGCATTTATTTCATGGCCTGCATTTCATTTTTAGCAAGAAAATGCCTCCATTCAAAGCGCCAAAATAATAA
GAAAATAATAAGTGATTTCCATTTTATGCCCAACAAGTGAATGTGATAGTGTGTAATGCAAAGTCCCTGTAATAATGTCCCATTGAAAAGTTGTGAGGAG
GGCTGCCAAGGTCATTTTATGCATCGGGAAGCAGTACAATACAAAATCGGATCTTGTAGCGTCGATCAAGGCAGATTGTAATGAAAGAATCACGAAGACA
TTTACAAATCTGATAAATCCATACATAAGCGCTTCCTGATAGTGTTTGAGGGGACGGTAAGAAGATAATCCACAGAAAATGTTAACGTGATTATACAGGC
GTCATATTGCTTGTTAATGCCCAATCTGAGCTTCAAATATGTATTATCTCAATCGGGCACTTGGTGTGCTGAGTGCGGGATATTTCACGATTGCTTCAAT
TCTACAAACGAGCCAGCTTGATAACATCAAATAGACCGACGTCAAATCCTTTTTATTTCTGATAAATACTAGAACAGAGGTGTTCTTTTCGATAAAATAT
TCAGCACTAACTTATATATTTTTAATATTTTCTGCACGCATTGTAGCTCTCCGATATTCTGTGTGCAAAAAGGTGAATGATGTCGGATCGTTCATGCATC
CAACAAGTTAAATTCTGCAGCAGTATTGGACTATAAGCCGACACCAACGAAGGATGTCAGTATCGACGAGGGTGGAAGGGTGCCATCTATTTCCCGTTGA
TCTGGCGGATCCCTTCCACCCGATAAAAATAGTGATAATAACACCCAATACAAATTAGTGAACACCTTAGTGGTATGCTCTTGGAATGTCTTGTTATGAC
ATTAGGGATTTGTAATGCCCTTACCACATTAAAAATGTACAACATGTTAAGACTAGTTCGAGAATTTGTACCGCGCTACTTAGACGGTATGTTCATTCAT
AGCCGGGCTATGGACGTGTAGCCAGATGAGGAAGCCCACCAACTCCAAGTATATAAAGCTTACATCGTCGTGAGCATAAATTGTATTTTTTCAACCTCAA
TGAGTGTATTTTTGCTGCGAGCGATAAAACACTACTTTGGTACAAAGTCGGCAAAAGGCGTGTCCCTGACCCGGAAACTATATAGGCGATCACTGGCTGA
CGTGTGCCAATCGATGTCAAGGGAATTCTAAAGCTCATAGAAGTTGTGTAGTGCCTGCAAAGTACGCTCGC