Description :
From Genome Similarity Track
Location :
Scaffold_59:118816- 120479
Sequence
1663 bases(100 bases per row)
CTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGTT
CATTCCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGTTCTGCAGAGC
CTGGTGGTGTCAACACCGTCTGAGCAGCTCGAACGCGTCAATGCTGGGACGGAAACAATAAAAGAGTCGTGTAAAAGTACGTAGTTACCTTCATCCATCA
CATAGTAGCATCTGCTGAGTCTCAGCTTTCCGTGTTCACGGCAACCAGAGCCCAACCGACAGACTGAAATGCATTTGACGCGTACGAGCAGGACCTCATC
GCACATGTGCGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAG
GCGAGAACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAGCTGCGTGTTGCTTTTGCACTCTCCAACCT
TAGCGGCCGTGCTAAGAGTTGGGTGTACACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCCCAGCTGTGCGAACAGCTCCGAGCCGCGTTC
CGCCCGGCGAACTACGAGTATCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGGAGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCA
CGGCGTCCCTAGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGT
GCAGTCAAGCACCCTTGAAGAGGCGATTCAAGTGGCCCTTCAAGAAGAGTACAGCCATCGCCTGGCGCGTACGCCGGCCTCCGCGTGGCCGGGGAGCTCC
TTGTCGGCTCCCGGTCGAACACGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGAATGTGGGAAGATGG
GCCACTTTAAGAGAGGCAGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACA
GGGGAACGCCGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCC
CTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGAT
CGATTCTGGGGCGTCGAAGCATTTCGCACGCCGCCAGACGGTTGCTCGCAACAGCAACAAGTTGTCAGATGCTTTGAGAGAAAGCAAGGGCAACGGGACG
GTGTCAGTGCGACTGGCCGACGGGGAGGTCGTGGAGGTCGTCACTGTCCCCAACAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCAAACA
GTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTAAGAAGCA