Description :
From Genome Similarity Track
Location :
scaffold_6:118809- 155574
Transcript NameFunction/comments
Pl_112783U4/U6.U5 tri-snRNP-associated protein, putative
Pl_112784hypothetical protein PHYSODRAFT_554382
Pl_112785elongation factor P, putative
Pl_112786conserved hypothetical protein
Pl_112787conserved hypothetical protein
Pl_112788conserved hypothetical protein
Pl_112789conserved hypothetical protein
Pl_112790conserved hypothetical protein
Pl_112791conserved hypothetical protein
Pl_112792hypothetical protein PHYSODRAFT_475011
Pl_112793hypothetical protein PHYSODRAFT_554371
Pl_112794hypothetical protein PHYSODRAFT_474636
Pl_112795hypothetical protein PHYSODRAFT_472216
Pl_112796conserved hypothetical protein
Pl_112797conserved hypothetical protein
Pl_112798hypothetical protein PHYSODRAFT_475526
Pl_112799hypothetical protein PHYSODRAFT_471379

Sequence
36765 bases(100 bases per row)
GGACTGCGTTGAGAAGGCCGATTTAGTTGAAAAGATTTTGCGTGTTACGCTACCGTCAACCAAGTACGTACCGTGATATACCTCGTATTAGTTTCCACGT
ATTTAGATTATGTGATGCATGTCACCAGATACAACTTGATTGCCAATATCTGCCACGACAGCCCAGTGACTACTGGCCAAGAGGCAGCACTTCAAACGAA
TCCATTGACGGAAGGCAGCTACCGTGTTCACGTCCAGAATAGAGTACGTTGCTTGAGAACATGTGTGCACAGGATCGACAAACTCAAACTTATGAATTGA
TGTGTCCATGCATTTGTCTATCGTAGGCGACCGAGCAATGGTATGAAATTCAAGATCTCCACGTCCAGGAAACGATGCCACAGCTCATCGGCGTGTCCGA
GTCGTATTTGATGATTTACGAGCGCAAGGCGTAATACACCCTTGAAATATAGCCCACGAATGCGCTCGTCATACTGCAGACACTCCATACTGTTGATTCC
ATGCAACCAGCGCTTCTATCGTAGTCGAGGATACGCTTGGTCGAACCCGCGTGAGCGCCACCTGGAAGTCGGATGCGTTGATCCCTCGCACGTCTTCAGC
CTTTACATTAGCTACTTTTGCTCCCAGCTCGCGAATTGGACCTAGAGCAGCGTCCTTGCATACAGCCTTGATATCACTGCCTGAGTAGTCATCCGTTGCT
TTCACGACATGCTTGATATCCCTCGATGACAAAGAAAATTTCTGCGTGCCGATTAAATGCATGATAAGTCCTTCGCGAGAAGAAGCATCCGGGAGGGGTA
CTGCCAATAACGAAAGAAGGGCCATACAAATTAGGCGCTTCGTATGCCAAATTGTCGATTAGAAGAGACGTACCGTAAATGCGCTTCTCCAGGCGGCGTA
CGATGGCCTCATCGAGCTCCCGAGGAAGGTTAGTAGCCCCCATGACAAGGATTCGATCCTCTTGTGATGATGCTGCTCCATCGAGCTCAGTGAAAAACTG
CAATTCATCATCATTTAATACGCTCACTTGCTGTGTTATAACCGATAGGCAGTATGCTTCGAATCGTACCTGATTCTTTATTCTTCGGCTTGCATCATTC
TCTGATGCTGACCTTGTCGACAACAGAGCATCGATCTCATCCATGAAAACCACAGATGGTTGAAGCTCCCGGGCCATCTCGAAGAGCGCTCGAACCAGTT
TCTCGCCTTCGCCTACCCATTTGGACGTCAAGGATGATGCAGATATGCTGCAGCAAAAAACGTAAGTATGGCATGATATAGATAAGGCAATCCAGAGCAT
CATCTTATTCACGAACGTACTTGAAGAAAGTTGCGTTCGCCTCCGTAGCTACAGCTTTTGCTAACAACGTTTTTCCTGGTCCAAATCGATAAATACGAAA
AACATTAGCATGCAACGCTCGTAGAGCTAGTAACCACATCCCATCACCTGTGCCGGGTGGTCCAAACAGTAGTACTCCACGAGGTGGAGCCCGCAAACCT
GTAAACAAGTCCGGGCGCAGTGTAGGCAAGATGACAGCTTCCTACATGCACAATCAGTTAGTCTCACAGAAAACCCATTCATCCAATCGTTTAATTGATC
AACCTGCAGAATTTGCTTGGCAACGTTCAAGCCTGCAATATCCTTCCAATGCACTCCTGGTGAGTGGTCCAACACCTCATCCAGAATAGTGTGTGCATGT
TCAGCATGCTGCTTCGAGTATCCTGCTCTCTGTTGCTAAACCCATCCACTATCGTTAACTTGTGGTCAAAGTCTTCAATTCCACCAACAGTTTCTCAACC
TGTCGACCACTAGCAGTGCGCGTAGTCTTCTCCTGTGTACTCAACACAGCTGCACTCTACTCAACATAAACATAAAATAAAACTTCAGTCCAACACACTT
AACCCACAAACATTTCCTCATCTTCTCTAGGACCTGCGTCTGCTTGCGCGCCTGATCCGCCGTCCACTCCTTAAGGTACTCGGCCCGCAGCATATACCCA
TTGATCTTCTGTCGCAACTGCGTTTTGTCCTCTTCCGTCGACAGCTCTGTACAATTAAGCATGCAAATAACTCAATACAAGTCTTCTGACCGGATATTTT
CCGCTTCAACGTACGTGCCAGCTGCGCCATCATCTTCTCGATGCCCGATGCATAGAGCTCCACTGCTTCTTGGTATTTCCCCGCTTTATCCGCTGCTACA
GCGGCCCCAATGGTCTTCTGAATCGTGTCATCGGGACGACGGCGCCACAGGAACATGCTCGATATTGAAGAATGGTGAATAATATCCACTATTAGCCGGA
TAACATCCACATGGTTTATCCGAATGATTAGATGTATTTTAACCAATGAACGCACAGGATTTAACGAGCGGTGCTAAAATCCACACTTTTTGGTGTCTAT
GATGCTGCGGCGAGCTATCACGCACATCGCGCGGGCGACAGCCCCTGCACGCGGCTACGGCGTGCGTTTTGCCACGATTAATGGTATGAGTTCGTCAAGT
ACTTGCTGTGTCGCTTAATCACACCAGTGTTGTAATATAACGCTTAAAATTTACAATGATACGCTCAATTGAACAGGCAACCAGGTTCGTGCTGGCATGG
CACTCGAAATTGACGGTAAAATCTACCGTGTGGGCAAGAACCAGCACGTGAAACCTGGCAAGGGTGGTGCGTACGTCCAGGTGCGTTTATACACAGCTTT
GCGCTAAACTCCATGCAGAATAGCGTGAGATATGTCTTACCGAAATGTGTCATTCGCTGCAGGCGGAGCTCAAGGAGATCAAGACTGGAGCCAAGATGAA
CCGCCGCTTCCGTGCTGCGGAGACCGTGAACAAGGCGTCACTGGGTCCGGACGAGCCGTTCCAGTTCCTCTACTACAATGGGGATCACCTAGTCATCATG
CACAATGGGACGTTTGAGCAGGTATGACATGCGATCTGATATTGAATCCGATGATCAGATATTAATCCATAGCTGATGGCAGATGGAGATTGAGCGCGAC
CTGTTCTCAGGTCGACAACTGGACTTCTTGCAAGAGGGCATGACGCTATCACTGCAGATCATCGAGGGCGACGTGCTGTGGGCTAACATGCCTGAGTACG
TGACTCTCGAAGTGACGGTGAGTGCAGCAGTTGGTGTGCATTTCTCTGGAGATTGCCGTTCTAATGCCGTTTGTCACCAGAAAACGACCCCTAAGGGTGT
GGCGGATACGGCACTCAGCATCAAAGAGGCGACACTAGAAAACGGTGCCGTGGTCAAGGTGCCGCTCTTCATCGAAATCGGCAACAAGGTCAAGGTGTCC
ACGGAGGACGGCGCGTACGTGGACAAGCTGTAAGCCTCCGACGCAGCAGATGAGGCGTCGCTAGGTACTCCATTGAAATGATGTGTCCTCATGGACCCCA
TCGAGTCTAATTGACGATACCTACCTTCACTTGACAGTTTCCTCACCGACTTGTTAGCACGACTGCAACTTCGTCATACCGCGGTCTTTGACCAAGTGCT
GTCGTATGAGGACAAATGAGCGCACGCACTTGCGGACGCAGGTGCAGAGCCATCAAGGTCTCGATGTCTGCAATGTGTCGAGGCGTTCTCGCCGTTTTCG
GCGAAGGTGCGCTGTAACCGCACAACGTATTACCACGTCCTCGCGTCTTGGCCGCCAATCATTGAAGATCATGGACACACCCCGCGGTTTCACCAAAAAT
CATGGCATGCTGCCTTGGCGTTTTGCATCTAAGGCCTCAAATCCTCGAGCCGTGAGTCGAGACCTCGAAGCTGGTTTGGGCGTGAGAAAAATCGATCTGC
TCCTTCGTGATTGATCCCTTCGACGGCACGACTGGTTGTGCACTGCCTCCTCTTGCGACCTTTTACAGTACCGTGGCGCACGCCGTCCAGTTGGTCATTC
ATCCTTTGGTTCAGTCCTCCGCACTCGACAGCTTCTCCTTAGTCATGGCCAACGCCACCGAAAAGGTCGCGCCGTCATCGACCGAGCACCAGCACCAGCC
CACTGGCGACTGCCCACACGCCGTGGCCTCCACCATCATCCGACGTCATCGCGACAACCGCCAGCGCTTCGATTCGGCCGACTACGAGATGGCGCAACGT
GCCTCGGGTCCATGTGCCGGATGCACGTGCGGCAAGTGCGCACCGACGGACGGCACAGATCTAGAGCAAGAACCGGAGCCTGGAACTGAGAACCGGCAAG
AACTTCGGTGTCTGCGACTGCAGCGCTTCGACTCGGCCGACTGGGCCTTGCAGGTGCAGCGAGCTCAGCAGGCTCCACAGTCGGACTCGCCATCGACAGA
ACCCGCTAACGTCGCCCAGATGCTCATGGACCGACACGCACTCAAGCCATGCGCGTTCGTAGGCCCGAAACCAGTCAAGAATGGCGAGCACTTTGAAGAA
AAGGCGTAAGCCTCGGCCGAAGCCCCTCGTTCTTGTAGCTACTACCTCTTATGATAATATATACATCACTTATCTACCTTACGCTGATGGAGTTCAGCTT
GTAATAAGTCGGTGGATCATCTGCACAGCTCAAACAGTCTTCAGCGTGTTGAATCAACACGCCCGACGCACTTTAGCCCAGATTCCTGCACACAGAGTCA
TCGTCAATGCAGTCACAAGCATCGAGGCACTACTGATCCAAAAGATCGAAAGTTTCTTGCGCGTGGCAACCACGCGCTTAGTCCAAGCGGCACGCGCCTG
GAATTCTCAGACATTTCTGCTACGTCCACGCACAGAGGTCGTTCTTCTCGTAGACTCGACGGTGGAGCAGTAATCGCTATGATCTGACGTTTGCATTCCT
ATCAGACCCTGCCATGTTGGACTCGTTGAGGAAGCACGCACTAGGTAGGTCTTATCACGTGAATATCTCGGATGACGCTTGTGCTGAGCTGAATCTGGTG
CTGATCTAGTGATCCTCGTGGCCATCCTGTTCGCCACGTACCGGCTTTCGCGACTGGAAAGCGAACGTGGACGGCGTGGAGCAAATATCGAGCAAGATGT
GCGTTGCTTATGTGTGGACAATGCTCGGATCCGATGTCCTCTGACGCCATGCTTTTCGCAGTTTGAGAATGTTGTAAGCTTCCTGCACCGGCACCTGGAT
ACCAACTACCGCGTGCTTCGGGTAGCTCCGTCACCACATTCAGTGACCAAACTGCATGCGATGGTGGTCAATGGAGGCTTTGCCATCCCACACGTGGGTA
CGCAGCTGCATGACAGTTTTTACTACATGCACTTCAATGACGGGTTTGGTGGTTTGGTTGCTGCAGAAGCGGAGGTTTTCGTCGATCAACTGTTCGCACT
CGATCAGCGCAAACAAAAGCGAAAAGATCGTCAACTTTTGCCACCTGTGCGTTTCCGAGTTTACGATGCAGACGCGATGACATCAATTGCGGAGGTAAGT
GCCTCTGTTTCTGTTGTTTGAGGTCTAGGTAGTTTAATGGTCTAAACACTACCATGTATCCCTGTAGACTCTTCAACAACGAAACCTGATCGCCTCGTAC
GAACAAGGATAACACCTCTCTGAGGTGGGGGATTCACAAGCTGGATTGAATGCTACGTGAATCTCACAGGTTGAACATGTCAATCTCCTCTTCCGATCCA
TCATCTGCCTGTGTTTCTACTGGAGCGTTGTTTCTGCCTTTGGGGATACTAGATTTGGTGCATTTAAGGGCCTGTTCTAGCTGAGCATTGGACTTCCAGC
CGAACTGGATGACTGTAGCTGTCAGATTGTCAAGGCTGCCTTTCTTGTAAGCAGCTTTGACGATAGCATCTGCTGCTGCTTTGGCGTCGTGGAAGTATGG
CAAGGCAATATCCACCACATCTTGATCACTCAATACGTCCCAAACACCATCACAAGCAAGCACTACGAACAAATCTCCAGATTGGACTGTGAATCGCTTC
ACCACTGGCTCACACGACACAAGTGGCGTCGGAGTTTTCAGAGCTCTGTCCCCAAATGCTCGCGACACCGCCAGATACGTAGATGCTTCGCGTTGCATAG
CTAACCCAGCTCCTGCCGCCGAGTATACACGGGGGATACCGGCAATATTGCCCACAAACCCACCAGCTTTTTCGATCCGCTGCTTTTCATCCGGACGATC
GGGTTTGTGATCACTTGTGAGCGGCATACTTCGGCCACCACGACACAAAACTGCGCGACAGTCACCAACGTTTATCGCGTAGAAACTTAACTCACCCGGT
GGTTGTTGGCTGTCCTCCACACTTTGCACAATCGTTTCGCCTCCAAAGCTAGCCGTATCGGTCAAGAACCAAAGTAGGAGAGCGGTAGAACCATCCCCTG
ACGGGTTCTTCTGTAAGATTTGGGAATCGACTCGTTCAAACGCATCCTTGAAAGATTTCAAGAAATGGTTATGTTGTTCATGACACCACTTCCGCTGCTG
TTGTCGTCGTACTGCTTGCTCAGTATCAATTTGCGTAACTTCACTGTCCATCTTTGTAATAGCGTCCACAAGTTGATCCACCAGAGTTTGTATCTCGTGA
GCAGAGTTTTCTGAATCTGGAACAGTGGAATCTGACTTCATGGCCTCTAGCTCTGCACGTTGCTGGCGCAGGAACTTTATTTGCTCAACTATTGCATCTT
TGCGTGATTTCTCTTGCTTTGAAAGTTGTTGGGAATTGTGTAGATTAGCGAGTGCTTTGCCTCCAACATTTTGTCGTATCGCCGACGCAACACTCTTCAC
AAGGTGTCGAGACAAGAAATCAGCCGAAAAAATTCCGCCATGACCGTCAAAAATGCCAAACACTGGGCCAGGGAAGAACTCAATGGAGGCTACGTGACGA
TCTTCATTGCTGGTTTTCATTCCTTCCCACGACTCGGTTGCGAACCGTAGTCCAGGAACTGCGAAACTTTTCTTCTCCAGCGCCTCTGTTCTATCAACCT
GTTCATCATTACGTGGCAGATAAGTTGCTTTCACCATCCTGTCTCCCTCAACATCATCCTCATCACGGATCTTTCGCTTGGACATATTCTGCGTAATTGA
TTCGTGACCCCTGATGGTAAATTGAAGATACTGTTTATCCGTCGTCCTCCCCTTTCGGGCACTTTGTGACGATCTGTACTCTGTGCACTAAGGTAGCGTT
AACTCTATGCCATTTTAATGATGGACACAGACTACTTAACGGGATGGAGTTGAAGCCCAGACTTCGACGAAGCACCCGTAAGACCACGGTCGACATCACA
CAACAACGGGCAAATGCTGGTTTGCCAATAAAGCACACATCACCATTAGAAGATAGTATTCAGGATGATACTCTTTGAGATGGACGTACACAGAGTTGGG
GTGGGTGATAGGCCATTGAAGCCACAAGTCCTCAACTGCTTGAAGCACACGTTCATGAATCACAACCACACAAATCGCATCATATCCACCCGCTGAAAGC
ATCACGAGTTAGCACAGTCGTTAGAGCAAGGCAATGTAACTTGTGAACGTACCCCCTGGGACTCCAGCAAAAAGAACGCCAGGAATCGCCAACGTAGCAT
CGAGGATAGCTGTCTGCTCCACTGGCTCAATAGGAACTCCAGCTAAGTTTCCCATTTCACTTCAATGTCAACAGATTGTCAATACTGTTAGTCCTAAAGT
TGGTTGCATCAACTGGCCAACACTAATGAACATACCGCATGAGGTCTCGGAAACGAGAAAAGACCTCACTGAGCTTCAGAAGCGTTGCCCCAATCTTCGC
ATCTGTAGTACTCCACTGCACAGATAACAGTGAATATCATCACGTGAAATTCAGACAGTTCGGGGCATACCTGCTTGTAGCTCTGAGTAGCCATCGTTTT
CCAATCTACTGGAGTGTTTTGATTAGCTTCCAATTCGCAGATTTCAGCGAAGCCTCGCTCAATCTCCAAGTTGTGGCGGTGAATTTCATCCATCACACTC
TTTGCCTGCTGGGGCTGCTCCTTTTGCCACTTCATCACTTGCCGAACCATGGACACAGTCGCCGAGCCAGATGACACGTCCCCCATTAGCAAGTGGAAGG
ATGAAGGCAACCGAACGGATTTCTACCAAAAAGACCATTTTTGTTAGCAAAACCCCATGAATAATATGTAGCTGGCATTACCACACGACTCGAAGTATTC
CACAATGTACGGTCCGTAATACAGTTTGCAATCTCTTCAGGCTTCATTGCTTCTTCTGACGTGAAAGTGTTCAAAATTGACGCAGGAAAACGGGTATACC
GTTGAGAACCGAAGCATGCTGCGGAGACATCAAAACCGCTTCCAATCTGTAGATCATTACAAGGAACAACCACTTACTCGACTGCGGTAACTCTGGGAAA
CCCGAAACATGTACCTTGCGTTGGACGTAGCAGTGGCTCAACTGAGCTAAATTGTGTACCAATTCGAGATCCTTTTCCTGCACATCAAAGTTCATGGTCG
GCACAAAGAACCCCATGAGAGCTGCAACAAGCGACGTCACAAGAGCAGCGGAACTTCCCATGCCGGTCTTTAATGCAGTCAGCTTGCCACCACGCTCTTC
GCAACAACTGTCAGAAAAATCCCAACAACCTAACAACACTCGTAAACTGACCTTCCATCGTTGGAGGAAGAAATGCATCAAGTGCCTTCAAATTGGTGCG
ACTAAGCTGTAGCTTGGTGTCTTGCAACTAACAAATGGTCCGCGTCCAAACGACGTCAAAAACACATCAAAAAATCTCCACAATGAAAATCACTGTACCC
TCTGCACTTGCGAGTAAAAGTCATTGTCACCACGTAGCGTGACATGCACACCCATCTTCGTCTCTGCTAGCTGTTGGAATGTATCATTTCTCTTGAACTC
CTCCAATCCAGCAACTCCGTTCACCGCACACAACACTGTCTCTTGAATGTACGTATTGTGCTGTGAAGTGTCCCTACCATCACTCAATCATCAATAAATT
GTCATTAATGCACCAAAAGGGCATGTCTCCACCTGAGTTGGAAACGGAATCGTCCATTGCCATTTTCCTCGATCCAACCGTCAATCAATTGTTTGAATTG
ATTACTTTCCACCGCCAATGGAAACAACCGACGCCATTCGCTTGAAGCAGTAGATCCCGCGCTTTCTTGACTGAAAACCTGCAATATTTGACGTAGAACT
TAGTGATCTATCAACTGACACATGTGTCAACTCTTTTTCAAAGTCGCACTTTGGCTTCTACTTGGGAGTAAAATCTCGCAGTACTCGACAGAACCAGCCC
AGAATATTGCTCGTCCAGCACCACATAGCCACCCACAAGCAGCACTTTGCCAGGCGCAGACACACACGAAGGTTGGAGGCTCGACATGGTAGTGTTCCGC
CACGTAGATACAATAATTGAGTCGTTATCTGCTTCAGTTTGAAATAAAAGGTTAGGTTTCTATTTTCATTGGCTATTGATTAGATAAAAATACCCAATTG
GCTAAATTTCAAATGTATTTCGTTCCCGTCTCGCCCACCATCAACTATGGCGTCGTCTTCGGCGCCGTAAGTCGCTTCCTCCGCCTCTAACGCCCGCTCT
CTCACGCTCTCTATGTGATTCTTGTGTCCGATAGGGAGCACGTCAACCCGCTGCAACAGCGAGCGGCCGCTGCGGCGCAGGTAACCGAGAATTTGCCAAA
TATCCAAGTCCCACAAGGATAATTCTTCTAACAACTATAATCTCTGACTTATTGTAGGCGTTGCTGACTCCAGGGCGCTCCGTCTCGCAGAGGGAGATTC
AAGCCATGTTGGAGAAGAATGAGGCGGCACTTAAAGGCTGGAATGCACTCCACAAACAGCAGCGTACGACAATTAGCATGGAAATGCTATTAGTTATTAA
GGAATTTATTTGTATTGACGCGTTTATTCATTGGTATAGCTGCCAAGACAAATCCTGCAGAGCACAAGGAGTGGGTACGAAGATGTCTCATGTATCGCCA
GCAGATTGGAGCGAGGCTGGAGGTACTGGCGTCGCTGGCAGACAAACAAATAGCTCAGGAGGACGAGAAAAGTGGAGGACAACGAGTATCGCTTAGTGTT
ACTACTGCAAGACGACCAGCGACATCACAAAACCCGACGATGGCAGCTCCGAGTGCTGGTGTTGCACAGACTCAGCAACACCAACCTCCTGCAGTGCCTC
AACAGGTTTTCGCACCTCCGCATGTTTCGACGATGGCTAGCAGCAATCCAATGGCGATGACCACGTCGGCTTCCATGGGACCTGTGCCTGCATCGGCGGT
GTCAACTTCGGGTTCGATGGCGATGCCCAATATGGTGGCACCGACGCCGCCTACGATGTTCCCGGATCCGCCAATGCCTACAGTTGGATTTGCGTTGACA
AGCTCGAGTATGTTCTTCCCGACAGGACAGATGAACCACATGCAGACGTCGTCTGGATTTGCGTCAACTACTTCTATGCCTGTATCTGGTGTTATGACGT
CTACTCAAGGATACCCGATGAGCTCCAGAGTGCAGACATTCACGCCAAACGCGTACATGACATCTACGAGTGGACCTCAGAGCTCGTCCGCTGCTTTTAT
GAATCAACAAAACTACATGATGGGTGGTGGGATGATGAACCCCCAACAGCAGTTTATGCCGATGCCAATGCCAATGAACCTTGCGTCCTCTGGTGGTGGA
AATATGTATGGCAGCAACAATTACGGCGTGTCATCAACAGCAGCGAACAATTCCAGCAGTGGAAATGGCAACAACAATAGTAGCAGTAATAACTATCCGG
TGGATCCGTTCATGACACCACTTGGGTTTGGCCCCGATGCAAGTTTCGGATCAGCGGGATTCCCCATGACTGGTATGCCAAACATGCCCATGCACCAACA
ACAAATGATGGGTTCAATGAATGGAGGCAATTTTGGAGTACAAGGAGCATCGATGATGCCAAACAATTTTGGATATGGAGGGATGCCATCATCGTCAGCG
CCGAATATGATGCCACAAACTTTGCCGACACAGCAGTTCCAGCCCACGCCGCAACCTTTTCAGCAGCAAAGTCAACTTCCCCAGCCAACAGGAGTGGGGT
CCATGAGCATGTCACCTGACACAGCGTTGTATGGTGACAGCAACGTAAATATTTTCGAAGGGCTGACAGATGATGCGTTCTTTCCAATGCAATGACCAAC
CTCTCCTCAACTCTGTCAGGTGTTCAAGTCGCCGTTTGTCGGTGCGTCGTTTACTATGTGCAGTACTTGCTCATTTCCTCGTAATCTCGACGAAGCAAGT
TGTATAGCCGTTCTCGTCGTACTGACACATTTGCAGAGGCATGAAGGCGTGAGCGAATCGACGGTGGGAAATTCCGAGAGGCGGCTCTTACTCGTCCAAC
ACACTTGTTTCCGACAAGGACCTCGATTTTGCGTGCTTCATCCCAGGTTTTATTAGCAGTGGCAGCGGCACGAGCTTCTCGATCAATCAGCAGATCGTTT
AGATTGGGTAGGCTGAAGGTTTTATGCTTCGGGTCAACAGATAATCGGACGGGTGAACGCTGATGTTGATGCAAGTTGAATCGACCAGAAGTGTCAACTT
TAGCTATTGATGCTGGTACACGACTGGGACTAGGATATTGTCGTTGCTGTGTGTCTTCTTGCATCACCCCCACGGTTCTAGTTGGTAGTTGCGTTGGGTG
ACTCGGGAATTCGCGAATTTTAAGAATTGATGCTGTCGATTGCAGAGTGACAAATCCCGGTTGCTGTACCTCAGGTATCATGTCTACTGCGAGGTTAACG
GTCGGATACGTACGTGTAGGAGGATGGAGCAGCGCGAAATGATGCTCTGAAAGTGCTGGCACACATTGACGATCATGACCAATTTCACGATACTGATTAA
GGAAGGATTTTGCTGTATGATCACCCTCGAAAGGGTCTTGATTACCGACGTACTTTTCGTATTGAAAGAGATCTTTGTGTGTTTGAAAGAACGCATTCGC
TGGAGATGTCTGTTGCTGCGCCATGGTGAACGGATGGATTGGCGGGCAAGAATGGGAGTAGCAAGTGACCGTTTGAGGAGGGGTCGGTTCATTTAAAACC
TGCCAAAGATCAAGTGAAGATGAAGACCGAGAGCTCACTGTCTACGCCGCCGACGCTATCATCTTCGCTGTCTGGTGCTCCCTCGTTTGTTCGCATCGGA
GATGGTTCTTTTTCGCCCGGGGACGTGTACGTGGAGTGTATCGTTCCCAAAGTTTTGTCGAGGGAACTCAAACCTGAACCGGTCCGGGCTGCAGACAGAG
CTAAATGTTGGAACACGAAAAATAGCAGTTTGGGCAGCAACACAAGCTCCCATCCAAGTCTCCTGTCTGATACAGTTGTGCTGCCATTTGCAGAGCACCC
AGCAATTCTTCAAGCGCAAGAGGATTGTCAAATCCTCATGAATGGTAACGATGTTTGCGTTCTCGAGGATGAGACTGTCAAGGAAGACGTGGTGCAGATA
CTCGGTAACGATGCTGAGCTCGTATTTCCAGTCCGCAACATCTTCCGCTACCTCGTGATGTTCATCAAAAACATAGACCTCTTTCTGGAATTCCACATCG
AGGTATTGGACGATACCCAGAAGTACCGACAGTTCACTGTGACTAACACCAGGTCGCTAGCACGCGTTGAGAACTCTAGATGCCAGTTGCCACTCGTTTT
TGGGTCTCACTCTGGTTGGCGATACCTCTGCATGGATTTACAGGACCTCACCAGCCAAGCTTTCGGCACTAAGCATTTGACCACAACTGAGGTGCGCATA
GGAGGCAATTGTCGTCTATTGCGGATGTTTTTCCAAGAGGAACGCTATGCTGATGCTGACTTGCCCGCACATCTCACTTTTCTCAGCGCGTAGGAGAGCT
AGCCTAGATTCGGCAAACTCTTCGATTCTACAAATGAAGTCATTGATTCATACAGCCGAGTTGCTTTATTTCTTGCGTCTTCGTTTGATATTCCTACAGG
TACGACAAGTTGATTGTGTACTGCGGGTCTCGCTGGTTGCGTTGGCGCGATACCTCAGTAAAGATTCGGTGATTAAGCCACAGCGACTCCAGATAACGGT
AGCGAGCCATATCCAATCGAAGTGGACGTCCCCGTTGCAGACCAACGTCTTCTTCGCCGTGGATATCCACGTATATGCTAGGGAAGTATGCTGACATGCT
GCCACCAACAACCGCGATCCGACACTGCTCGAGCAAAAGTACAATGCCTACACCACCTCCACACTCCGCAGCGTGACGCGTACACTCACCCACAGGTGGT
CCATGTGGCATGAACGCACGAGTGCAGCATGAGTCTCCACAGCACAGGAATTCCCCGCAAATCAAACAAAGGCCAGGATCACAAGGCGCTTTTTCGCATC
GTGTGCACTTTCGCCCTGACATCTCGCTGTACAGTTCGTCGTACTGGATAGGCAAGTCGATTAGTCGTGGTCGCGTAGGCACTTCGCGTAAGATGAACAT
GCTAGCAACATAAGCCTCGCTGCAGCCTTCTGTGTGCTCACACTTGTCACCAACCTTCGAGCTACCCAGGTGTGTCTTGCTGAGCATGCGATCCATGCAC
CATTGCCAGATTTGATCAAACGTACCGTCTGAACTGCGAGCGATATCATCTAACGTGGGGATTTGCATCGTCTTGGTGTTTGCGGGCACATTGACTTCTT
GTTCCACCAGACAACGCCAGAAAAGTTTCATACGCCGAACAAATGCAGCACTGGCTGGTAGAATGCGTCGCAGTCGAGACTTTACGTCAGATACAGTTGT
AAGTGGTTTCAGCTTCTCTGTTGGGAAAGCCTTCGTCATCCTTTGCAAGAGTTGGAGTGCAGCATGCGCCTCAGACTGCCCCTCACCAGAAGCTCTCAGC
GCTTCCATGAGCTGCTGAACCGATCCAGCAGCACTCGTAGAAGATCGAGTAGACACGGCTGGGCTGATGGCACGGCCACTTCTAGTGCGACGAGGGCCCA
AAGCTATAACGCTTGCTTCTGCTGCTGGCTGTGTGGACTCGTCACCTTCTTTTGCTGTGATAACGGAGAATTTATCTTGAAACAACGAAGTTCCCTGAGC
CTTGCTTGTCTCGAAAAATTCAGAATGTAGACGCTGTAGTAAATCTGCAGCAGTAAACACCGGGATAAATCGCCAAATGGTGTCGAGCTCGTCAGCAATC
ACGCTCGATACCACAAACGCCTGTAGCAAAAGAAACCAAACGCATTAGAACAGTGGATCCCACAGCCCACTACAGCAGTTCTTTGACGTACCGTGAACGT
GTCCGCTACTAGCAGACCCAGAATAGTCCCTCGAAGGCATGCATCAATCGAACCAAGCACCTACCAATGTCAAAAATTGTTAAATGTATCATAACCTCAA
TGCGTTCAGATTCAGCAACTTACCTTTGTGAACTTGCGATAATCACGCTTGGTCTCGGCATTGATCGGGCAGCAACGTTTTGCCGTCTCCCACACCACTT
TAGCATCAGCACAGTGCTCTAAAAGGGAAAATGTCCATCGGCAGAACTTTGTGACAGCTATCAGAGACTCCATTTCCTTCTCCAGAGATGGTGGACAGTC
ATCCGTTAGTGGATCGAACGATGTACTGCTTCCGGATACATTTCGGTATTCATCCTCAGCAACAGTTAAGAACGACGCCAGCGTGTATGCACACGCAGAC
CACAAGAAAGGTGCACCCTTTTCAAGGCTACCGTGGGGCTCCCAGAGCGTATCCTCGAAGTAATCCCGCCACATATCATGTTCCGTGTCGTTTTCATCAT
CTTCAAATCCTCCATCACGTCCAAGCACTGAACGATGCCATCCAGGCATTGACAATTGCTCCTCTACGATCGTGTCCCAAGTTGGAGATTTCTCTTCCTC
ATCCCTTGACGATGTCACCATAGAGCGCTTCTCCTCCAAGTTTTCTACATTCGCGATGGAGGTTCGGGGCTCGGACGTTGGTATCAGAAAATTACTCAAA
GTTTTGCACAAAGGGCACAAGAACTGCGTCATTGCTGAATCCGGATCAATCGCTTGAACACCGTCAAACTCCTCACCGCGCATAGCCTTGTCATGCAATG
ACGTAATATATCGCTCGAGACAATTAATATGCACTGCGTGCTGGCACGTCCGGACATGCAGTCCACAAGGAGTAAGGTACAGCTTGGCACTTTCGTGGGC
CCTGCCAAATCCAGGCGGCATGCGCTCTAATCGAAAGCGCGATGAAACATCTTCATAGCCATCATCATCGCTATCGTACATTGCACCTCCTTGAGCATGC
GCATTGCCAGCTCGCGCTCCAGCCATCTCACGGCCTCCCAATCTACGCGGCTCTACTCTATCACCGCGCAGATCCAAGCTCACCGCTCCACGCATATCCA
TGGGAAAAAGTTGTTGGTCCTCACGGAGGTCAAGAACACCTTCAAGAACCTCCAATTCTTCGTCTGTCTGTAAAAGTTCGCCCTCAAGCATTGGGAGGTT
TCCATTTCCAAAACGAATGCGGTCGTTGCGAGGTCGACGAGTTGCAGGCGGACGAGGACTATTTTGCGCGGTGTTCTCGCGAGTGAGCTGGTCTCCCAAC
GATCCATCCATGTACCATTCAGGAAAAGATGTTGCGAAAGCACGAAGAGTGGGGGACGGAGAATTCGCCGTGTCAGACGAGGCCGCGCTTCCCCCTGAGC
ACAACTCCATCTTTTCGATAACCTCCTTTACGTGGTTACGAACCTTCTTGCCCTCCGAACCAAGAGCTTCATTAGGCTCTGGTCGAAATCCAGGGGCTAG
CACGGTAGATTGGTGGACATACGCCGCCATTCCCATCTGGCCTTGTGCCGAGCTGTCATGACAGAGAATGCAGTTGTAGCAGCGTTCGTTTTTCACATTC
CGGTGCTTCTTCGTAGGCTCCTCTACTTCGTCGGTCATCGATGCCTTGCGCTTACCCAGCGAGGAATTGAAACTACTGTCAGACTCTTCCTCTCTTGAGT
CATCTAAGTTCTTTTCGCTACCTTCATCTGCGAGGTCGACCATCGCCTGAAAAGCGGCCTGGCGTTTGGCCATTGCAGCCATAGCTCTCTTCCTTGCTTC
TATTTTGCGCTGCTCCAACGTCATAGGTGAAGAGTTATTTCCTTGCACAGGACTACGCGTTACCGACACTGACGACTCAGTCTTCTTTTCCTTCACCTTC
GATTCATTCGCCAACTGCTCAAGTATTTTTTTGCAGGCAGGTGATTCTGTTGTGATCTTCCAAATGAGCCACTCCACCGTTCCAGTCTGTTCGCCGTCAA
GTAATGTCGTTGCATGCTCCAGCAGCTTGCTCAAAAGGATTAATACAGAAAATTTGGAGGCAGCAGCATTCGTTTTGCTCAACCGCGTCCAAAACCGGCG
ATCTGATACTAGCGATGCTGTGTGAACGCCATGCACCAGTAAGTGCAAGCAAGTTGAAATAACAGCATCTGAGACATTGTCCGGCGTTAAAGGGTGAGCT
GAAGCAACTACCTTCCACAGAATTGCACACACGATCGCCACTGTACTTTCACACGTCAAAATCGCTTGGACTGGACGAAGGAAGTTGACGGGATGCTTGG
CAGCCTTCAATGGCTCCCTCGGGGGGGCATCGGGGGTAGCTTTTTTCGACTTCTGGCGGGATGAGTTACGGTAGTTCGTCCAACGATCGCGTGCTAGCTC
GTGTGATTCACGGTTCAAGTGGAGGAAGTACGGGTTATAGTTCTCCAATAGACCCTCTTTCAATTCATAGCGGCCAGGCTCAAGTCCCGACGGCGGAACA
AAATTGGACACTTTTGTAAGAACATCTTCCAATCGCGCAGTCGGAATATCATCTTGGCCTGACGGCAGTATAGCGAGGTCAAAGAGTTTGCTAAACGGCA
GACTCTTTGCACATAGTTGTTGAAGCATCTCTTCTGCGAGGAACTCATTGTCATAGGCTGCACCAGTCGCGCTTGGTAGACTAGTTCCGATTATGATCAC
AAGGCGTAAAAACTCCTCAAGCATTTGGTAACGTTGTTGAGCATCAATACCCTGCTCCAATCCCGCATATCCTGCTTGCATTGCCAGAACGTCCATGTCG
GTCTTCGGGCCAAGGTGAGATTCCAGAATAAAAAAACTGCAAAGTTGGAACCGATCTACCATTCGTGCCACGAGTGCATCTGGCCCAGTCATGAGGACAG
CGAGCTGCAGCATTAACGTGTCTGCATCACGGTAGTGAATGCAATACGGCAGTGCTGAGTAGTTATATAACTGCGCCAGCATGTTTTCGTCTCCATTTCG
GCGCCACAGGTTGGAGTGGATTTGGGATGCCATCACCAGACAGCGTAGGGGCAACTCCACTAGCTCCCATTGCTGGTCAGTCGACAATTTATCAAACCCA
AAAACCTTTAACAGGCCATCTGTAGGAATAGAGTTTCCTAAACCTGTCTGGCTGATGCAGATATGCCGTACCGCAGCGGTGAGGAAACGGTGCAAAGGAA
TGTGGAGAGACGTCGGCTGAGATGCTACGTTGAAGTCGTATGTCAGAATGGTTTTCTCTCGGTTTCCAATACCCCGCTTGCTGAGAGACAAAATTCTCGC
CACTGGCGACAGTGTCTTTTTCACCACTTTTTCATTTAGGCGAGCCGAAGACAAAAGAGCGGCGTCGATGATTGGTCCAAAAATTTCCGCTACCTTCATT
TGGGGTGTTTCGAACTGCGACGGGTTAAAACCGTTCCAGGAGATTGCAAACACCGAATGGACGCGGATACCAAGGTTAAACATCGATAGCCAGCTATCTG
ACTCGTATTCCACGTGATTCTGGTGAATACCTCGACGTACTTGAGGATCTCCACCCTGTGACAAAGTGGACAACGATTTGTGTCAGTGTTAATTCTAGCT
AAAATGGAAACAGCACTATAGATTACCTGGAGGATGCTCAAGCAAGATAACCAAATCTTCAAATTGTCCTCATGGCACACAAGTTCGCTCGAAAGTGTTC
CGATATTAAACACATACTCCATATTCTCCACGCAGTGCTATGCCACGACCAAAACAAGGTAAGGATTTCGTTGCATCAAAATACTTCCATGGCTGACTAG
ACAAATAGACTCACCTTGTACTTCTGGCTGCTGAGCGCAGGATGGTCAGCATTCAGAGTATTTTCCTTTACATCAACGGCAGACTGAAACACCGTGTTTA
GAGCACAAAGTAACTCACGCACCAATTCCTGTCGACCAGGGTGTGCCGATACTTCCTTCTTCGAATAGTTTTGAACGAGATGGGGTACCGTTAAAAATTG
CACGGCAAAATCGAAAATGGATTCACTGGAATTTCCCAAGCCACGGAGGAACATACTTGTCATGGAGGCATATGATCGTAGATATGCCTCTAGCATGCTA
GCTCGAAATTGGATGTCTACCAAGTGTTCACGCAAAAACGCATGCGATTTGTTTACTGCGTTCTTTCTTAAAGTGCAGTCGTATCGCATCAGCAACGTTA
AAGCTGAAGAGGGTGTCGAGGGTGAATCAGAAGTCGTCTCATCCGACGTGAAATACTTCGCCACCACTGCATCAAAACTCTTTCGTACAGCGTCATGGCG
GCGATACGATGAGCTCAGTGATACAGCCATGACAAACTCCTGAATAAATATGTTCTTGCAGCTTACGCGGTTTCCTTCAGCGTAGAATGTGGTGGATGTG
ACTGTAGTTGTGATCCCTTCGCCCCGGAAATCAAAACGTTGACGCTGGGCTGTCTCTTGTTCTAACGCCCACGTATAGATGTCCTTGTCTCCTGAAGTCA
GCGCAATAAGCACATCCAAAGCATGATTGTGTAAACGAATATTGCGTTCCTTCACAAATTCCTGAACCGTCTTGCCCTTAGGTAGACTGCTTGATACGGG
TAGAAATCCCATAAGAGCAGGGAACCGTTGTTTCTGAAGTGCTTCAGACACAAGTTCGCTGAGCCCATCGGAGGTTGTACTAACAAACTGCAGCCACTCC
AGAAGAGCAGGTATTCCTTCCATCTGCTTCTCCCACCACGTCGGTGCCACTGAAATATTAAGCGAACGACGAACTAAGTTTCCTACAACAGCTGGACATT
GCAGCAGTGGCTTAGTTGAAATCGTAGCATCTCCCTGATCATCCACTTGGCTGACTGACGACCGCGCCTGAGGCTTGGACATCCCCAACTCGACGTAAAG
ATGGTTAATCACTTCGTTCAATGAGTGTACGTCGTCATTATGCAGACGAATTCCAAAGAGTACTCCATCATTCGAACTATTACCAATAGCGGCACCAGTC
TCCTGGTTCACTTCTTTAGGTTGTGCCTCCAGTCGTCCGCCTGGTCCGTTTGTTCTGGCACCAGGTTCAGCCGCGAACTGTGCCGACAGTCGCGTAGATC
TTGTTGACGTCGGTGTTGAACTGTTCCTCGTTCTGCTCTCCGAAGCGTCTGCCACGTCTGTATCACTCTGAATCGGCAGAAATTTTGGCGGTAGATCTCT
CGTAAACAGTTCAAACGCTTCCGCGAGTTCAAATCCATACTCCGTTCCCAACAACACCTGATAAATATGTTCCACTACTGCACCAATAACCACAGGTGCC
GTTGCTCCAACATGTTTTGGCAACTTGTGCTTCTTCGTACCCGTCTCCGTCCCTTCCGCTCCTTTATGTCTCGAACAAAAGCCACTCTGTTTCCATGCCT
AAAACATAAAAAAAACAAATATCAATCTCCACTACATAATAAAATAAAACCCACCCAAACGCACATGAACATCTCCACAGTCACATGAACTGCCTGCCGT
TGTTCTCTGGAAGTACACGTCGTGACCTGCATGGTCGCTGTGCGTGAAGCAATCCTTGCACATGACGCACGTGGTGTCTAACTGGCAGTTTCGGCAGCTG
TAGGCGATCTCGTCGGCCGAGAAGATGGCGCCACACACGCGCTTACGCTCTGTTCTTGGCAGCTTGGCCAGAATCTGCGTGGGCGCCAGTGTTTTCTCCT
TACCATGGGCACAAAGCGCCGTGAGCAGCGCATTGCAGGTACTAGAGACCGCCTGAACCTCGCCATGGGCCAAGTTGCTCTGTAGAGCGAAGCGAATGAG
CTCTAGAAACTCTTCTTCGCGGTGACGCGCGACATTCTGCTGTGGAGTAAGACGTGTGGCGGTGTCGGCCTCGTTGGCGGTCGACTTGGCCTTGGACGCC
GCCTTGGGCTTAGCCGTCGCCTTGGTCTTCTTGCCTCGGATCGCTACCATCACTCTGCAAGCGAAAACGGAAGTGAATAGGCTGAAGAAGCTTCTGGGCT
TTTGTCACTTGACTTCAGTAAGCTGATGGTTCAGCGTGTACAGTAAATGCGCGAATACAAGCCCGTTTCTTTTGCTGGACCACAACGCATCGTGTTAAGT
GCGATTTTGGTGGTCGACGACGGTTTAAGATACACGTTAGCTTGATGGTGACGTTAAGCGTTGCGGGAAATGGAATATGGTGTGTGGAGGATGGATGGCC
GTGGTTAAGGATTAGAAGTGGAGTGGGAAGAGCTACGACAATTGATGACACTTCATTAAACTCACATTGTGCTAGTGGCTGGAACAGCAAAGGTCGCTTG
TTGTTAGAAACGTGTTTGTTGAACAAAGGTACTTGGAAGAAGCATCTTCGAGTGGACTTGCACGGTCAACAAGATGGGGTAATTAGCTTTGAGTTGTGGA
TTGGTCCGTCTCGCTCGACGGATTTTCTTCACTTTGGCATGGCGTGGACCGTGGACTTAACGCAGTGGATCCAGTCCGGTGCGACGAATCGGTGGTATGA
CATTGGAGATACCAGGACAAGACGTCGAGGGGAGGTTAACGACCAAGAATATTGTGAAAGTGCGGTAGAACTGCAGAGAACAACACCTTATATCTCGGTC
GGCATTGCTGGTGTTGAAGATTCAGTTTGTGAAGTGCCTTTGACTCAAGAACCTCCCACTCATAAGTCGGCTTTTCAGCTTGTTCTTCCACATCGGTCAC
TCACTAGAAAAGGCAAACTTCGTGCAATCCGGGTGGGTCAAATTGTACATGAGGTAAGACTTTGTTTCTCAGTTTAGGGAACATATCTGCTGAGACTGCT
CTGGTACTAAAATCAACAGCTCCGTACCGATGTTTTGCAAGACTTGCTGCCATTGACCCTTTATAGTAAACGCAACGCTAGTAAACGCTCCAGCTCAAAC
AAACCAGTAGATCCTACTAAAGGAATGACGAAAGCGCTGGTTCTCCTCCAGCTTTCGTGTCAGTACGCAAACTACTGTGTCAACGAGCTGGATCGGTATG
CAAAGTACGTATCTGAGCCTTTTCTCGATGAGTAATTGCTAACCCCATGGTACATTTAACTGCCACTTTGATTATCCAGCAAGCTGGAGAAGCGAAGTAT
CAAGCTCCAGCACACAATTCACCGAATGAAAAACAATCAGAACCTGTTGCAAGAACATAGAGCAAACCTTCGGCGTGAAGCTGAGGTCTTAACGTGTTCA
CTCGACGGAATGCAATCACTGCTTCAGGAGTTGGACCCAGAAACACAAGCTCGTCTACACGACGATGAAACGCAGGAGATACCAACCTGAATGCCTAGCA
TTATATGGCCCGAAGCTACCGTTTACCAACAAACGAGCAGTACTAACATTCGACGTCAACTCTGAATACTTGACTAACCCTCTTTCCTTGTTCCTTTAGT
ACCTACCGCTTTCCCCGTACGACGGTGCAGCCGCTCTTCTCGGATACGCCTCACACGCTCCCGCTTCTCCTCCATCTCTTTTTGGTGCACCTCCTCAAGT
TGTCGCTTAGCATCCTCACGTTGTTTACGTGCAGATTCACGGATGCGTAGTTCACGCTTCTTTTTGTCTTGTTTCAGCTTGAGCGCGGCCTCCCTCCTTT
TTTCATAAGTAAGCACCTTACCCTTGTGTTTGGTACCGCCAGACTGATCGGATGTTTTGGATGATGGAGTCTTTCTTGTTTGATCTGGACTTGCAGCAAC
ACTACTAGGAGTAGAGCTCAATGATACAAGTGGCGGAGGAGGAAAGTGTCCGTGACCTCTACCTAGTGTGTGGGCTACCAGCTTTGGCGTGTTCGTACCA
CTATGGGAGCGAGAATGCGGTGGAGAAGGTGAAGGTGGCCCACTTGAGGCGCTTTCATCTACCTCGGGTACAGGAGCAAGTTCCATAAAGAGATTGTCTG
ACGACGCCACACCAGGAATTCGTCGCTTCTGTTTCTCTTCACGCAGTTCCGCCGCCTCTGTCTGCAGTGCCTCCACCTTACGTAGCCTTGCATCTTCGTT
CTCACTGGTCTCTTCATATTGTTCCTGCACATCTTCGTTATCAATTTCTTTCTCCTTTAATAGCACCTGTTCCTTCTTCTGTTCTTGCTCCAGCTCCTGT
TCGGGCTCCGGTCGATCCGTCGGTTGCTCCTGTTGAGCCATCTTCGCCTCCTCCACATCCATACTAATCGCAACATCTCCACTATTGCTATCCTCTCCAG
CACTTGTATTGTTCTCAGTCTGCTCCTCCTCTCCACTCTCCTGTATTTTCATCTGCAGCCACCAAATCAGCACAATTTCATATAAATCCTCTTCTAAGCG
TACGCACTTGCTCTGCAACGCGATGAAGCTTCTCGGCCACTTCGTCCGGGAGGAAAATGTACTCTCCGTCGATCTGCATGTTGTTGTAGGCCTCCAGAAT
TAAATCCTCCAGTGCCTCGACCATTTCGTCCGCCTCCTCTTCGCTCTCGACAGGAGACATATCCGGAGTCTCGGACACAACCGACGCTTCATTGGACGGC
GCGGAAGGCTGCGTCGCTTCCGTCGATGTGGTCTGCAGTGCAGCAGTACCAGCCTCGACGCTTTCGCTGTCCACTGGCGGCGTCATGGACGCTATGAATT
AGCTAATTAGCAGCATGGCGTTCGTATGGCATCTTTACCTGTAAAATGTGATAAAATGTGTCTATTCATTCTTGCAAATGGCTACACCACTGCAACATGC
AAGATGAGTTCTAACGTTAATGCTAATTTCACACTGCAGCCTCTGCCTGTGCCTTGGCAAGTCGCATTTCAGTCAGGTCGTCAACAGAGGTCGACGCTTC
TGGTCGCTGTGAAGACCCACCAAACACCGGCTGCATGTATGTTGTGTCGAAGGCTTGCCAGTTGCGGAAGAACATCCCGGTCAGCGAATCACCACGAGAT
CTTTCGGCAACGCGATGGACAGGTGAAGCAAGGTTCGGGTCGTCATCGTCATCGCTCATGACGTCGTGGAACTGCGGTCGCGGAGTGTAAATCGGGACTT
CGTCTCCTGTGCCGTCGCGATTCTCCTTGGGCTGCTCTTCCTCCGGGAATGCCAACGTGCCATGGACTTCACCGTCAGCGTGGCGCGTGCTGCGCTGAAC
CAACCGCGATAGCGTTTCTTCGGACTCCGATGCAGTCGCAGAATTGCTATCTGTGTCAGACTGGTCAAGGTGGCTGTGGTCTTTGTACTTGCCAGTGAGG
TGCAAGTTCACCAGTAAAGGACCCATAATACCACCGATCACGATCGTCGTGATGAGAATGACCACAAGAGTTGTTGACTCGATGAGTCGGCGATGTGACG
CTCCATGAAGACCAACGTAGTTCCAATTCTTAGCCAGAGCGAATGCCATCGAGCCGCGAAGGCCTGCGAGCCAGATGACGCTCATGAACTTGACCGGAAT
TCGATTGACTGGAGAGCGCAAACAGTTACAGATGCTTAGTAGCGGGAAAACATTGAAGAAACGTGCAATAAGACACGCCACAAGTGTAAGAACGATGAAC
GACCAATCGATATCGTCGACACGCAGTGAAGCACCAGCACTCTCCTCACCATGACCAGCGAAAATCATGATGACCGACGTGCCCATAAATACATACACAA
TGTTTTCGCAGACGAACGCCAACGTGTGCAGCAGGTGCGTAAACGCATGTTGCGCTTCTCTGGACAATGTGTTGAAGTGATAGTGCGCCGTCATGGTACC
CGAAAAGAACAGCGCCACAATGCCACTCAGCTTCAAACTGTCCGCCACGAAGTACGTCAACAAACTGAAAATCAAACACAACGAGATCTCGTAACTCGGG
TAGTAGCGTAACGTTGCAAAGAATTTGCGCTTGAGTAGGAAGGCTCCACCAAGCGTAATAACTGCGCTCACAATCAGAGATCCCAAGAACATGCCACCAG
TATTCAATGCCACACGTAATAGTTGCTTGGCACTAAAGTTACTGTCAGGTTCCCACTTGTGCAGCGTCTGGTATAGAGCAATCGCCACAGCATCGTTCAT
GACACTCTCACCAAACACAAGATTGAATAGTAGCGGCGGCACGTTGAGTTTGTCGAAGCAGCTTAGTGTAGCCACCGTGTCCACAGCACTGATCAACGTG
CCGAACAGGAAAGCTTCTACCCATGACAATTTGGTCACCATACCAGCCACGCCTGCGAGGTACAGCACACCACCAGTGATAGTCGTGGCGATGACTGTAC
CCAGCACGGCCGTACTCATGATGGCTGGGAAGTTGCGGAAGAAGACTGTGCACTTGATGGAGAAGCCTCCTTCGTAGATGATCGGTGGCAGCAATACATT
GAAGAAAAGACTGTTGTCCAGGTTCAGATGTGTGTGCAGCGCCGCATGCTTGCCGCCCATGATCATGAAGAGCCCCACGAAGAGTCCGAACATGAGTGCG
AAGCTGCTCTGCGATATAACCATGCACGAGTAGCGCCCCAGCACGTAGGACGCCATCACCAGCACGAACAGCATGAGCAGCAGCAGCACCGCGTCCTCCA
TTGGTGGCGCGTGAGTCCCGCAAATGGGTTTGTGAGATTTGGATCAGAGTTGCTGGCTCTAGGTATGGGACATGATTTAGTCAGCAAACCGGTACGATTT
GCTGAACTCAAACACTTCGCTTCAGTATGTAATATTCTATGTACATTACACAAACAAAACCGGTAAGTTGAAGTTGCTCAGACCGTCTGGGGATGCATCT
TGTCAATTTCTCCATGCGCATCTGTTGCCTCGTCAACTGGTCTGGGGTTCGCAGGGGACTGGAAGCCACCGAACATAGGCTGCATGTACGTTGTATCAAA
AGTCTGCCAGTTGCGGATGAATGCACCAGTCAAAGTCTCGCTGCGTTGAGTTGGCGAGTCGCCGTTGCGGTCTCCCTCCTCGTCACTGTAGTCCTCATCT
CGGAACTGCGGTCGCGATGTGAACACAGGATCAGCTTCTACCTCAGTCTCTTGCTCTCTTGTAGTAGCACTCTCAGAGACTTGAGGTGCTGCTTGCTGTT
CCGTGGTCCTCGAGTTTCGACGAAGCATGAAGTGGCGAGTGCTGCGTTGCAACACGCGGGCACGATCTTCCTCAGAACTCGCATCTCCTCCAGGATTTGA
CTCAGGCTCAGTTTGCCTTAGTGCACTGTGATGATTGGTGAGGCGTAGCTTGAAGAGAAGCGGGCCTGTAATTCCGCCGATCACGATTGTCGTAAAGAGC
ACCACAACAAGAGTTGTAGATTCCACAAGTTGACGGTGAGAACCATAGCGACCGACATAGTTCCAGTTCTTTGCGAGCGCAAACGCGATAGAGCCACGAA
GAGCAACAAACCACATTACGCTCATATACTTGACTGGAATGCGGTCAGAAGACTCCCGCGAGCAGTTGGAAAGCTTCAGGAGCGGGAAGATATTGAAGAA
ACGCGCCACGACGCAGGCCACAAGTGTAAGCCCGATGAAGTGCCAGTCAATGTCATCTACCCGAAGCGCAGCGCCCGAGTTCTTCTCTGGATGGCCCGAA
AAAATCATGATCACGGATGTCCCCATGAACACGTACACGACGTTCTCACACACAAAAGCCAGTGTGTGTAACAAATGGGTAAATGCGTGTCGAGCCTCTC
GTGACAGCGCATTGAAATGGTAGTGAGCTGTCATAGTTCCCGAAAAAAACAGCGCAACAATACCGCTTAATTTCAGACTGTCAGCGACGTAGTACGTCAA
CAGACTAAAAATCAAGCACAGACAGATCTCATAACTGGGGAAGAAATGCAACGACGAGAAGACTTTGCGTTTGAGCAGGAAGGCGCCGCTGAGTGTGATC
GCCGCACTCACAAGCAATGACCCCACAAACATTCCACTCGTGTTGATCGCCACTCGCAACAACTGCTTCAGACTCAAATCAGTACCAACGTCCCATTTGT
GTAGTGTCTGGTACAGTGCAATAGCCACTGCATTGTTAATCACACTCTCTCCAAACACGAGGTTGAACAGCAACGGCGGGACGTGTAGCTTATTGAAGCA
CGATAACGTAGCGACAGGGTCCACAGCATTAATCAACGTTCCGAAGAGCAGCGCCTCTACCCACGAGAGTCTCGTCACCATCTTCGACGTCCCAGCTAAG
TACAGCACGCCGCCCGTAATGACCGCAGCGATGACTGTGCCAATGACAGCCGTGCTCATGATAGCTGGGAAGTTGCGGAAGAACGCCTGCCGCTTAATAG
AGAAGCCTCCTTCGTAGATGATCGGTGGTAGCAACACATTGAAGAAAAGGCTGTTGTCCATGTTCAGATGCGTATGCAGTGTCGCGTGCTTGTCCCCCAT
GATCATGAAGAGCCCGACGACGAGGCCGAACATCATCGCGAAGCCGCTCTGCGACACCAAGTTACACGAGTATCGGTCCAGCACGAACGACACTACTACC
AGCACGAACAGCATGAGCAGCAGCAGCACCGCGTCCTCCATTGCAGCCGCTTCGTCATCTCTCTTGTGCTGCATTTTCACTTTTCATCGAGATAGGTATG
GGAAGCCGGTGCTAGGTTTTACGATAAATCGTAAAGAATAGCGCTAAAATGGACCAGCTGTTTTTTGTTGTTGTATGTGACGAAGCAGCTGTAGACGAAT
GCCACGTCAAATCTACTTCTAGGCCCGAGTTGCGTTTAGCGGTGCTCAAATCGCGGCGCACGAAGAGCACGGGTGCCTCCCTTCTTAAAGCGCAGGATGC
CCATGACTGCAGCCGCAATGCTGCAACCGAACCTGTACATACATCCGTTTATCACTCCTCTACCACGATGGATCACTGAGTAGAACCTGCTTACCAGGTC
GCGGCGTATCCTGCGTGCTTTTCGGGGGTCATATAGAACTCCAGATAGGACGAAATACTTTTTCGGAGGGGGTTGTCCAGCTCCACCTCGCTGCTCGCGC
GCTCAATCGCTTTATAATGATACAGCACAAACAGACCACACAAGTTAAAAAAACTTTGGCGAAGGAGCAAGAAGAAACTAAAGTTACCTACCAAGTGCAT
CGACGATGACAGGCAAATCGGCTGAAGTGATGCCCATAGCATCAGTCAGTTCTTCGTGGTCCAAATAGAAGAACTGGCGATTTTTGGGATCGTTGTCTGG
TGTGAAATTGTTTTTCTGCACGTAGTCCATTGAAGACAAGGTAAGACATTGCAATAGAAGGTCTATACTGACTGCAGCACGTACAACTTCACCATGACGA
AGTACACCAACAAAAGACACTTTACCATCCTCTTCTTTCTTGTCGCGTGCCATGTGTACATCCAAAAGCTTGCGCGGAAGCCAACCACGGTTCACGATCA
CTGGCGTCCTAGACGATCCCATAACATGGATTAGTTTCGTGTAACAAAGATCGTAAATTAATAAGGCATCTTACCCATTGTCACGTTGCAATAGCGAATA
AATGTAGCCACCGGACTTCACTCTTGCCACCGAATCACTCGGGTCAGCGGGTGCAGAACGAGGGTCTGCCATGGTCAATGCACGCCACAGTATCAGAGAT
CAAATTACAAGAAGTATCAGTGATCATTGCGTCAGTGAAGCATTCGTACACAAATAGAAGGTACTTCCAGGCTTGAAGTTCCCCTCAAGGCGAAGCTGGC
GATATTCAATGTCGTCACTGACAATCCAAACCGTGAGTTTCAATGTCAATTTCACCACGCACACGGGGATCTCACATATCATCGCTTGCCGTCGCGTCCT
TCGGTAGCTCTGCAACTGACTCCGACAACTCCTTCGCGCGCTCGTTGATCAGATCCACCTTCCAGTAGTAGCGCTCGGTCTGCAATTCACATCATCATTA
GATCCTCTAGCCATCGCACAACCAGATCTACATGTACACACCTGCCACGTGCCAAGGTATGCTGTTGTCACCGTCTACAATCACACCGCAACAAACGCAA
CAACAGATAATTTACAATGACTACATATGTACTTCTCCTAGTTCCAGCCGAATCTGAACACACCACAGCACCGAAGAACGCCATACCAGCGTATCTGGAA
AAGCTGCTCTCATTGCCACTTGACCCTCCAGTCTTGGATTGCGATGCAGACGCCGCGAAGCATCTCGAGCTCGTCGATAAACGCGGCACCACCCGCAGCA
GTCTTCGCCCCAGCATTTTCAGCTTGATATGAAGTTCGACAAAGGTGAGGACAGCAGTTTTGGCCAATCGTTATTTAGAATAAAACTCGTTTTTAACCAA
TTACCGATGTTATGATGCCAATCAAAGCACCATCAACCAATGGCTTCTGACGCTGAGGGACACGTGCTGGGTAACTTCCATGCGTACTACAGCTTCAACC
CGGTGCACGAGCGCTTGCGATTTATGGACGTGCAAACAGCCAGCGCTCTCCGACGCGTTTTATTGGTGAAGAAATCTGCCGAGGGCAACGGCGAAGAGAC
GTCCACGGTCCTTGACGTCGGCTGCAATGAAGGTGATTTGACTATTGGCCTCTACGATGCGCTAGACGGACGTGCAGTGCTGGTAAATGCCGACCAAATT
GACGACGTGGCCAACTTCGATCTCAATAATATCAGCACACTCAATGAGCGCATGCAGAAGGAAAAGAAACAGGTGGAATATTTGATCCAAGACGAAGGCG
AGACCAGCCACCGGAGACGCTACGTGTGTGAGCTGCAGATCGACGGCGAGACGATGGGCCAAGGCGAAGGTGTATCCAAGAAAGTAGCCAAGGCCAAGGC
AGCTGAAGTCGCTCTGCGTGTGCTGGATGGCACGGACGACAAGAAGCCGGAAAAGGAGGCATCTGCGGACGATGTTGTCCCAGAACAGCTTCCACTGACG
AAAGAAGAGTTGGCGAAGAGGAAACTACTTATGGTTCTTGGGGTTGACATTGATGAGGTGCTGATTGGACGCGCTGCCAAGAAGCCTGTACAGCTGACTG
CGGGGGATGCAGTGCAGTTTTGTCATGTTGATGTCATGACCAGCAAGTTTAGCAAGGAGATCACGCCGTTCTTGGAGCTGGCGAAGCGCTCGACGGCCGA
GCGGAAATTTGACCTTATCACTTGCTTCAGTGTGACGATGTGGATTCACTTGAACAACGGAGATGACGGCCTTTGGAAATTCCTCGAGACGGTCAGTGAC
ATGACCGAGCATTTGATCATTGAACCGCAGACATGGAAGTGCTATCGGTAAGTGACAAACTGCAACGCTTGCTGCGAAGTGATGGTCGTACTGATTTTTG
CCGCTTTCTTCTGCTATTGTTTGTCAACAACAGTAACGCGCAGAAGCGGTTGACCCGCATGCGCGTTGAGGTGCCTAAGTCCTTCCGCGAGATCAAGGTT
CGCGCGGACGTCGTGGAGAAGATCGATGCGTTCCTACTGGCTGCTGGCCGGTTCCGCTATAAGGCCCAACTAGGTAAGACGAACTGGTCGCGGAACGTCG
TTCTCTACAGCCGCAAGCCTGCTCCTGGGATCACTTACGTCTCTTGAACATCGGGATTACTACTCGGGTGACGAAGTTGCCCCTATAACCAGATCAATAC
TAGTACAGTGTGTATCTATCTCACGTCCATGAAGCAAACCCACCGATTACATCACTAGTGATCAGTCCTGACAATAACGCACACCTCATTTCCAAACAAG
ACGTAATGGAGGAAGTGCAAGGTTACAGAGATATTATACGTGCCCTGGCTGTGCTATTGGCCGTGGTGTTCGTGCCGACGCTAGTTCGTATCCGGCTCGT
GTACACATTCCTATGGAATGTATTTACCTTTATCGCCATCAAGATGGAGTCTTCAACGGCGCTCGGACTCGCGACGGCCATGGGGCTGTCGGTGATGGTG
TCCTGGTCCATGCTGAGATTCTTCGACAGGTCTGCATTCGACAGTGTGTTGCTCGGCTGGTTCGGTTTCATGAGCAAGTACTGTGTCTTCCGTACTCTCG
CCAATACATGCGATTTCTTACTTCATCTCGCATGTCCGTTGACGCTCGCTGCCAAGTATCTGGAGCATGTCGAAGTGTGGATGGCGCTGCCGATCTTGGG
GTACGTAACGTGCTACTTGGGACTTGTCGTAACGTCGCTGTTAATTCAAATGGTGTACTTTTCTACAGCTTCTCCGTGCTGTGGGTGTACTTCGTCGCGG
ACGGCTCGTTGGTCGCCAACCACGTCTACCACTTCTCACCACCGCGTTCAGTGCAGTTCTGGGCTGTGGCAAGCGCTTCCATGCTTGTAGGCAACCTGAC
TGTGCCACTAGGCTGCGTGATAGCGCAGTGGAGCGGCGTACCCGACCTGATTGTCCGCTGCGTCCAAAAGGTGGTCGCATTCGTCGTGCCGCTCTACCAG
GCGGTTGTCCTCTAAATATTGACTGAATTCCAATTCCAGCGCGACATCACCTTGAGCTGAGTCAGCACTGCTGTTGAGTCCAAAGTCCACAAGAGCAATC
CCACATAGACGGGCTCGAAGTGTATGTACACATAAGGTAGTACCTTGTACCTTGTTTTTGTATGAGTGCTACCTCAGGTCATCATGGGTGTCTCGGCACT
CGACCCAAACGGACAATCAGCGTCATTATCCGTTCTGATCCTGAGTCATTCGCTGTGAACTTCAGAGTGTAAAGGCGTAGCAGCAGCAACATGGACACCG
CTGCGTTCTTGAGCGTGGCGCTCGAGACACTGACCCGCACGGTGCTACGAGTGCGAGAAGGCGAGCAGCGGACGGCCACGTCGACGCTCGATGCGGTTCA
AGCCGTGCTGCTGCTGTTTGTCATGACGCTGCTGCCCGTACTGGTGCGCGTGCGGGTCCTGTACACCTTCTGCTGGGTGGGGTTCACGGTATTGGCCCAT
GTGATCGAGTCCGAGGCGGCGCTGGGCATGGCCACATCGCTGGGTCTCACCATCATGTTGGGCTGGTACTCGCTGCGTGCACTGGACCGCGCCACGTTCA
TGGGCATTCTACAGGGTTGGTTCGGTTTCCTAAGCAAGTACCGGCCGTTCCGACTGCTGGCCAATTCTGTTGACCTTCTGCTGCACATGGGCGTACCGCT
AGCACTAGCGTTCTGCTACCTTCCGCTTGTGCGAGTCTGGATGACCGCCCCTATTTTGCTGTAAGTGAGCTGGTTGAGTTTGTTTGTAGATGCTTCTGAC
TTGTTGATTTTGGTTGCATGTCGAACAGCTTCTCTCAGCTGTGGATCAAGTTGGTAGCAGGTGGAGACCTTTGTGATACTGGTAACGACGTCTACCACAT
CTATCCACCACGTCCAAAAACGTTCTGGCTTGCGGTCCGCAAGATCGAGCTGGTCTTCAATTTTATAGTTCCAACGTTCTGTGTGCTTGCCTACCAAGCA
GGTATCCACGAGTTTGTCGTCAACTCCTTCTTGAAGCCGAACTTGTAGCTCATAGCAACTTTCACCTTCCCCAGCAGCTAGATAGCGCAATAACTGTAAT
AAAGCACCCCTATTGTATTTTTCCAGTGCAAGACACAATCTCAGCTCACTTGATATCCTAATCATCATAATGAAACCAAGTCAACCTTAAGACAACGATT
CGCTCACTCCGCAATTTTCAAAGATGGACACACTGCTCGGTTGGGGAACACTGGGCCGCGCCAGCCACGACGCCGTCCAAGCAGACAATCAAATGGACGC
ACCGTTGGCCGTAGCGCTGCTGTTTGGCGTGGTAGTGTTGCCTCCGCTCGTGGGCGTCCGTACCATGTACACCAATTGCTGGTTTGTCTTCACAGTCATC
GCGCATCTGCTGGCATCGGAGGCGGCGCTGGGTATCGCCACATCCATGGGCATCACGATCATGGTGGGCTGGTACTCGCTGCGGGTGTTCGACCGCTACG
CCTTCACAGCCATCCTCAACGGCTGGCTCGGGGTCTGGGCTAGCTCACCGCTGCTCGGCTTCGCGGCCCGTGTCGGCGACTTCATGCTGCATCTGTTGGT
ACCGATGCTACTGGTTTCGTGCTACTTACCACTTGTCCGTGTGTGGATGAGTGTGCCGGCTTTAATGTAGGGAAAAGTTGGGGGCTGTGAGTGGACGAGT
GGAGCTTTGATGCTGATTATTTTGCACTGTTGTGTAGATCGTCGCGACTATGGAGTCACTTTGTTGTGGGTGGTGGAGTTTTCCCCAAGGCTGACCATAT
CTATCGATTTTCACCGCCACGCTCGCAGCACTTTTGGAACGCAGCGTACAAGATGGAACTGATGTTAAACATGCTCGTCCCGCTCTTCTGCGTCTTAGCA
CACCAGGTAGTACATTGAACATAATTCCTGTGCTGTCTGCTAAGTCTACTAGGCACCATTGTCTTGCTTAGAGCTTGGTGGACACGTCTAAAATGCTTTC
TAATATCATGATCGTCCACCATGGATGTTATCTGGTGTTGATGGTGGACAGAGATCTTTCTGGGTGTACGTCGCGACGGCGATCGCAGGGGCAATTCTGT
TCTGCCTTCAGCTTATCCGTTCATTATCACTTCCTAAATTGAGGAAGAATGCAAAGACCATTATGTGCCGACTACTGTCCAGTGGTGGCATCCGACCGAA
TGTGGTAGGTTTTGCGCTGGTTCCGAATACTAGGTTAAACTACCATCGGCTGACGACGTATGAAAATTGCCCGTGTTGTTTGCTGCTTCAAGGACTTTAT
CGTTCGAGACGACTCGTTCTGGCTGGATTGGATGAGTGAAGGGCTTGTAGCAATCGGCGAGTCATATGTTGGTTGTCTGTGGGCAACTAACTCTGCTCGA
ACTCTAGACGAGGTGGTTGCAAGCCTGCTTACCATCCCGATGGAGGGTAGACAGGAGATGTACCGATCGTGGAGCGCTCGTTTTGTGGCACTGGCAGCAA
GATTGTTCAACTATCCTCCGTCATCCATGGGTCTCGTTGTTGGCGCTGTCTCCGAGCAGTTTGATCTCTGTCCTCAGTTTCGGCAGGCGTACATGGACCG
ATACTTTCACCAAGGCTTTGGTATTTGGACTGCGGGGACAACAAACATCGACGCTGCCCAGACTAACAAACTTGCTAATGTGAATCAGCAACTGGATATC
CGGGTAGGTATACGATCAAAAGACTTTGTCGTTCTTTTTGAAGCATCCTAACTTATTTATCGTTCTTCTTCAGGCTGGCCACATTGTTCTGGACATTAGC
GTCGGTTCATGGGGAGGTGTAGGCTGTTACCTTGCACAACAGCACCCCGACGCCACTGTAGTATGCGTGTTATCGTCCATTCAAGAGTTTGCACGCGCCA
AGAAGTTTGCTCGAGAACTTGAAGTCTTTGAACAAATGGAGTTCGTGGTTGCTGAGACGCCAAAAAAGCTCCTTACAATATTGAGTGGCTTCCGCGCGTC
TAAGTTCGACCGTATCACATTATGCGGTGTGGTGGAGACTGTGCCAGACACTCAGCGAACTCGCTTCCTACGCACGTTGAAGCGCATCCAGACCGCGAAT
GGCACGACGCTGCTTGAATTTAGCGCGTGCACAGCCGCTCATATGACGACACACGCTTGGACCAACAAATACGTGCACAGTACGCTCCCTTGCTATGCCA
TCACGCTGCCGTTGATGCGTCTACTTGCCAGCGAAACCGGTTTTACACTTCGAGACACACTCGGCTATTCAGACCACTACGAACGCACGTTCCTTGAGTG
GAACCGTCGATTCCAAGCACAATGGGGCCACGACTCAGTTGGTCAAGGCATGCCGTCGCTCCCCGAGTCCTTCAAACGTACGTGGGAGTTCTACCTGCTG
CACTCCGCTGGCTGCTACCGATCCGGTGCACTACAAGTCTTCCAGATCAGAATGGGGTAATCTAGTTGCGACTGTCAAAACTTATTACATAGCGTCCCGG
AGGACAATGTGTCCTCCTTCAAAATGATGGAAAACACACAATTTAGATTGGAACCAACAATAATTTTCAAATCAAATATTGCAATAATGGCTGCTGTGGC
TGGCGAATGGGAGAAGCACGTGGATGAGGCTTCAGGCTCTACGTATTACTACAACAGCAGCACAGGTGAGTCGTCGTGGGAGGTCCCCGCAGGCTTCACG
TCTCCACGTGCGTCAGATGCGAGTCAGGACAAGGCCCCAAAGTGGCGAAGGTTCGTGGACGACGAGTCGGGAGCCATTTACTACTACGATGAAGTGAGTG
GCACGAGTCGATGGGACAAACCAGAGGATTTTGTATTGAAGAAAGAAGAGCAGGATAATGGGGAGACACAAGGACCCGAAGAACAGGAGACGACAGAGCA
ACGGGAGGAAGCAGCACAGGAGCCTCAAGGAATAGAAGGACAAGCTTCAGATGACAAATCTGACAGCAATGGGAAGGATGGAGAGGACAATACTGCTGCG
ACGACACAGCAGTGGGTGAGATATGTAGATGCTAGTAGCAATAAGCCGTACTACTACAATTCCAGGACGGGGAAGACGCAGTGGGAGGAACCAGAGGGTT
TCGATGAGTCAGCAGTCCCGGTGGCTCCTCAGATCTCCACCGAGTACCAAGCTCATCTTAACCGGGTACGGATGGAACGCTTGACGCGGGTGACGCAACA
AGCTGTAGACCCGTCTGGCAATCTCAGCAAGCTGAATGCCATTTTGAGTGGGATTGATAGTAGTGCTCCTTCTGTGGCGACTGTGGAAGGAGAGAACACT
GATGCTCCACGAACAGCAAAAGCGGAATGGCAGCAACATATTGACTCGCAGACGCAGCGATACTACTACCACAATGTTGTCACGGGCGTGACACAGTGGA
ATAAACCAGATGCGCCGATTGTCTCGGGGGTAAGCTTGCAGAATACTTTATGGTGCTGCTTCGTGCGCTCATGCTTTGTGGTGTGATATTCTGTCTGTGT
AGTTGGCCGATTGGATCCCACCCGAGGTTCCTGAGGCAGATTCAACTGATACTAGGCAGAAGACTGTATCAGGTGTAAACTACGTCGCACAGGCGAAATT
CAATCGGCTTACAGGCAAATACGAGCAGCTTGGAGGTGATGAATATTGGCAAAATGCGGGTATTGCATCAGATCGTGCGGGACGGCAAATGAGCCACTTC
TTCGACATGAACGCGCTTGAAAAGAACCGTGAAGAAGCTCAGCGCAGGAAAGAGCAGTTGAAGCGGAAAAACATTGACTGGAAGAAGAGGACGGCGGAGA
AGAAGGCCAAGAAACAAAAGCAGAGAAATGAGTGGCTCTACATTGATTAACACGGAAACATGCATGCACCGCATACCCCAAATCTTGGCTCAAGTTGTTC
GCGAGGGCAATGTACAGCTCACAGGAGCCAAGCCCAGTGGTTTGCTATGACAGTACATGCTAAATGCAACGTACGATCTTACTTGACCTCTGTATTGCAC
TTAGTGTCCAGGAAACCAAGTAACTACCCAGACATTATTCCAAGATTTACAGGCCAGGGTACAAACCAATGAATCCTGGAGTCGGCTCGCCTTGAACTTC
ACCAAAGTACAGCATGAATGTCTGGCGCCACGTTTCCACCATCGCACGGTCAGCCATGAACTTCGGGAACTCGTCCACGTTCGCAGCAGCGATCTCCCAC
GGGTGGCTCGAACCGCTGTTGGGGGTTAAGTCCACACGCACATTCTCGTTCACGACCGACTTCTGTACATCCTCCGAGATAGCCCAGTTTACAAAGAGCT
TGGCGGCTGCAGGGTGCTTAGCCTTGTTCAGGATGGCGATACGTTGGCCCCATGATAGATACTCGTTGCCACCGTCCGTCACGAACGTGACGTTGGGTGT
ACGTGCCAATGCCAATGGTCTTATTCTTTGCCGCCACGAGGTCGCTGGGCGTGTTGGAACCGCGGCGGAACGTGACATTCTGGTTGGCGAGGTCCTCAAC
CCAGCTCCAACCATATTTCTCGACGTAGCGTTTGTACAGGAAGAGCACGGCATCGTCGTCATTTGGGTAAGATGAGGCGATCTTGCCAGCCCATTGTGAG
TCCACGAGATCGGCCGGCGACTTGGGCGCCATGACTCCATTCAATGCCGTCTCGTCGTACAGGAAGCTGAAGGTGAACATCATGTAGGCCATGTATGCGC
CGGACTGGTCACGGAAACCATCGTAGACCTGCGAGAAGTTGGCAGGTTTGTACTCGAGCAGCTTACCCTCTTGGGCCCAGCGAGGGAAGTCCTGCAGCGT
TTGCAATGCTACGAGGTCGGACACCAGCGTGTCAGTCTCGAGCTGGTTGTCGATGCGTACGTCGTGGTACTTGCTATAATCGACGATGAGTGTGAAATTG
ATTTCTGGGAACGCTTTGGCGAATGCGTTGTGCAGTGTGTCCTGCTGCAACGAGAAGTCTCCACCGTGATACTTCATGACGAGGTTGCCTCCTTCGGCGA
TTGCGTCGGCGTAGAGCTCATCGACGGTTTTGGTCTCTTCCTGGACTGCGAGGGTGACGGACGCGAAAAGAGCACAAAATAAAGCGGTGAGATGGATGTA
GAGCTTCACAGTTGTTGGAGGGGATTGGTAGTGGGGTGGTTGATCGCCGGTAAATTGTAGAATGAGGAGTGAGCTTGTTGTTATACCAAACAGGCGATGG
AGCAAGCAAGGTATTGATGAAGACGGTATCTTGACAAGATGATCGCAAGGGACGTTTCTGAAGTG