Description :
From Genome Similarity Track
Location :
contig_1:118801- 120676
Transcript NameFunction/comments
g19.t1hypothetical protein

Sequence
1875 bases(100 bases per row)
CAGCTGCTGATTGCGAGCGAGAAGGGCAGGCAGCGCGCTGTGTTCCTGCTGCTGCATCAAGGAGTGGACAAGGACCGATGCAGAGGCCTCGTACGTGGCT
GCCAATTGAGAAGAAGGACGAAGGTTGTGAGCTGACTAATTCGTGTTGCATGTTGCAGCTCGGCTGCTCTCCGGTGCATCATGCCGCGGCACGAGGTCAT
TTGGACGTGCTGCAGCTGTTGCTCGACTTTGGGTGGGGTGTGGACGTTCGCAACGACGCGCTAGAGACGCCTCTGCATCTCGCGTGCTTCGACGGCCACG
TGCACGTTGCAGAGCTCTTGCTAGACCGGGGAGCGGATGTCAACGCGAGAACGAGCGATCGAGAGACCCCGTTGTTTTACGCGACTAGGAAGGGCCAATA
CAGAACGGTTCGACTGCTTGTCAGACGGGAGTGCGATCTTGCAGCGGAAAACTGCTACGGCGACGTGGCGGAAGAAGAAGCTCGAGATGCAAAAACTCAA
GCTGAATTTGCGTCTGGAATCGAAGACTTGCAGCGAACGTCAGCAGTAGAGGGCCAGCGTGGAAACAGCGGAGAGTATACGCTACCACAAAAACTTCGAG
AGCGAGTACTGTCATTTTTAGATCTGAAAAGTCTCGGGTTTGCTTCACAAGTGTCGTATCGATGGCATCGAGCTTCGGATAATTCCTCGTTGTGGAAGAA
ACTCGGCGTATCACGGTGGGGATTGCTGCTTAATGCGGCGATGGGAATGGGCACGGTTCCTCAGATGTCGATGCTACGTACTGCTACGAGCAATCTCTTA
CGCTTGAATCTCTCGACAACGGTGTCTCGGCGTCCATCGAGCTGTGATCAAGTTTTTCCCGGCCGATTCATGCCGTTGAGTGCCAAGGAAAAAGATCGGC
CGCGATATCAAGAAGAAAAGCGACCTCAAACAGCTAACCTTGCAGGAATTTAGACAAGATTTTCCATCAATGCTGCATCAATCGTGATTTCTCTCAACCT
GAAGAACTTCTACGGTCATAATCTGTTAGTCAAAGGCATTTATCTTCCAGATGCTTGCAACAGTGAGGATGCTACTCCTGTTGTTGTCGATGTGCGTAAA
TTGGAAGTGGCGATAAGCATCCAGCAAAAAAGACAACGACCGCGATGGGGTTACCTTCGCTGCACCCCTAGCATTCATGTAGTTGCCCTTGCTCAGCTTT
GTCGGGGGTATACAGTGTGAGCTTTCATCCTCGCTCTGATCATTGCAAGGGTTTTTGCGTCTGCCAACCTGGGCATCGCTATTTCACCAGGCTGCGGGCT
GGGCTGATCGTTGCCGGATGCTGTTTTTTCGTACCATCAGCCACGAAAGCGTGTTTCGTACGGAGTTGGACAAGTTCTTCTGCAACCAACGCATCAACGA
GGTCAGCACTCAAGAAGGTAACCTCGACAAGCTTCAGGAAATATTTGGTACGACTTCACCAAACGCGCCGCCGAGGTTCGACCCGATAGAACGTGTGGGA
ATATATGCCCCTTTATTAAAGAGGTGACCTCGATCTCATTTTCCGAACACGTTCTTGGACTCCTGCAATACCACGGATAAAGTAGACAAGTGGTGCGGAC
ACCGGACTATGGGACTTCCTACAAACACATCTTCGCTGCTGACTCCATTCTCAGTGAACCCGGGAAAGTATCGCTCATTTCAGAGACAAGAGCGTGAAAG
TGAATTCGATTGGTTGGATTGGTCGTAGCATGGCTACTACCTCCAGCAAAATCGCCGCAGTAGCATGCGTGAAGCTGTACAAGTCGAGCCATTTAGACAG
TGGGCCAGCCGCTTGAGAAGTCGAGTTGGTTCCAGCCGAAGCGCTTGTCACCGTCCGCGTAGCCGATGCGAGTGT