Description :
From Genome Similarity Track
Location :
Scaffold_389:1188- 5140
Transcript NameFunction/comments
Physo_145013reverse transcriptase

Sequence
3952 bases(100 bases per row)
TCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCT
CATCCCGTCCGCAGCCCGGCTGTGGACGAACATATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACACACCTGTTGAAG
GTCGCAGGGGCGTTCTTCAGACCCTGCGGTATCCCTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCGTGAGAGGGATATCGCTCTCACACA
TGAGGATCTGATAGAACCCATCGCGCAGGTCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATAACATCTTTTCGCGGTATCGGTGTCTG
CGCCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGAT
TTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGGTTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGT
ACTTCGTGCCCGGCACGAGATCAATCTCGTGCTGGATGCCCTTGTCCTGCGGAAGTTCCGCAGGGATCTCTTCCGGAAGTACGTCCGCTTACTCCCGTAA
GATCTCGTAGTAGGGACTCGTTTTCAACGAGTTCCAGCTCTGCTCCTCAAAGCGCTCCTTCTTAGTCTTCGCACTGAGAGTGTCCTCACTCTCAGTGGTG
GTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCAC
GCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCACGCGTC
AAGACGTTCAACGTCTCGACGTCCGGCTTTTCAGCCTCCGTCTGTCCGGCAGACATTCCTTGTAGCGCCTCGGCCTCAGGCCGAGACTTGCGCAGCGACC
TTCGCATGCGCCGTCTTCTTGTTTTGCGGAGCCCGGCTCCGCTTGGATCTTGACCTCGTCCAGGCCCAGCCGCGGACGGGTGTTCTTCTTCAGTACTTCC
GGCGGGTTTATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCACGTTTTTCCGGT
GCGGGACGTTTGCAACCGTCCGCACCGCTTGCAGCGTCGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGACCCCCATTA
CATAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCACCCAAGCCATCGACTCCCGGAGTCGACGGCGCCTCGTCACCTTGGCTCTTATTATTGGC
CAGACCTGATCCAATCAGATTGGCGTCAGCGTCCACGGCTGAGGCGTGTGACTCGCCTGCGTCATCCGTGCCCCTTGAGGTCGGAGACTCTTCCTAATTC
GCTGAAAAGCGGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTTAGCCGTCGGCGGCGACGCCGACGCTTGCTGCTCTTGCGCGTGTGCTCGCGCGC
GCCCAGGGCGCCCCGGGACAGCGGCATTAGGCGCTGCTTGAGTGGGGGGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACT
GTTCCGCTGTCGCGACCGAAGCGCACTCTCGTGCGCTTCTCCCAATCGATGACCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAACT
TATCGTCCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGATCTTTATACGTGAAGCGCACGCGTATCATGCGCTTCTCGGTCTTCACGACGGCACC
CGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGAGTTCGCAGTCGAACAAAGTTCTTCGACGCGCCA
GAATCTACCAAAGCACGGAGAGAGCCGCTTGCTCTCATCGAGTTCACGTTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGAATGAA
CTTCGATGGGGGCTGCCGTCCTCAGTGTCGCATGTCCGAGTTGGACACGCGTGACTGCTTCACCAGTAGGGCGCCCCGCGCCTACTGGCGTCCAGCGTTT
TTTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGATTCTACCGCATC
GGTAGCATCGCACATTGTTTCTTTGCGACTGCTGGGGTCCAGCAGTTGCAGCGCTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTCACTATCGGGCG
AGGCTGTGGCTCGGCGCATATGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTGATGTAGCTTCGAGAGTANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTAGGTCTTCCATGCCCATCTCTCAGTCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGACCAAG
TACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGGAACTCATTTTGCGGGGGCTCAAACG
CTTGTCTGAGCTCCTCCTTGAAACCCTCATACGTGCTGAAGCACGTAGGATCAAAGAGTACGCCCAACTTCTCGCTCGTCCGCCAAGACATGACATGGCG
AACGCGACCTTCGACAACGGGTCGACGATGCGTCGAGCCGCAATGGCAGTGTCAAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGT
AATTGCTCACGCTGAGCTTCAGCGATTGCGCGCGCGGTGTCGTCCCCGACGACACCGTGGTAGACGAAGCAGCACCTCGCTGCTCCTTCATGATGAATCC
CAGAGCAACACCGTGTTGCTCCGTCGGCGATAGTGTGCGCAGCATTGCAGCTACAGCCGCTTCTCCAATGACTGTTGACAGTCGTTGGAGTGCCTCCCAC
TCTGGATCCGACAGGTGGAGGCAGTCAGCGCGTGCAACATGTATTGCAGGCGAAGTGGAGCTTTCCATGGGCACCTCCGCGCTCATGAAAAGGTTCTCGG
CTCATCGTTCGTACAGCTCCGTACGAACGTTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAGTGGGCCTACCTTGGCTCACTACT
ACGGCTTACACGTATGCGCACGTGTATGAGGAAGCGTAGGTTTCTTTTACTTGAGTTAAGTATACTCGAGATCCACGAGTATACTTTAAACAAGATAAAG
ACTCCAAGTAGCGGGTTTTGGGAAAAGATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAA
CGGCTGGTTGGCAGGATTCTGCTAACATGCAAATCACTCATTGGCTAAAAGATGCTGCTTTCAGCCAGAGGAATCCTAACTGTGTATAGACCACCCGTCG
TGGTGGTCGTAAATGTATGTAGACATTGGTGTACCTTACACCAAGGTCGAGG