Description :
From Genome Similarity Track
Location :
Scaffold_27:1188- 2651
Transcript NameFunction/comments
Phyta_totarag1439hypothetical protein

Sequence
1463 bases(100 bases per row)
TCAACTCAAATTACATTGAGCACCGCAGTTAGCTCCAGGTTGCCGCCTTGTGTGGATCGAGGGATCCACAAAAGCAGTGAGCCCCCTCCAGTGCCGGGGA
GACCCAGAAATCCTGGACGCCACCGATCCAAATACAGCGATTTCCCTCCCAGTGCCGTCACATTCGACATCCAATTCTCTGTCTTTCCAGCCGCGACAAA
CACTTCGTCGATCTTGTCTCCACCAGACTTGATGTTGACGGTCACATCCTCCGTGTCAACACTCTTGAATGTGACGGAAATTGTTCCATCACTAGCTCTA
GACCACATGCCGCCACTGTTGTTGAAAGCACCCTGGACAATCGACATTTCCAACGCTTTTTGAGCAGTACCGTCGTCTACCTCCCCGATAAGCTCTGTGG
GTCCGCAAATGGGCTGAAAGTACTCGGAGACAAGACCAGTGATTGCCCACATATCCCAGATTGCATATAATCCTAGGGCTTTGTCGGCAATCCTGAACGT
GTACTCTCCAGCAGTGAGATACGTCCCGTTACTACTTGTTCCAGCGCTAATcaggtcgtccacgatgcCTCCAAAGGTTTTGCGTAAGGTATCCCGCGTA
GCGTAGGCTGTAGCTTCGTCCGATGCGGCGATTAATTCATTCATACAGTTGTTTGTCGCGACTGGGATGTCGTTTAGCACCAGGTTCGACTGACTCATGG
CAACTCGAATGATATTCTCGGGTTTTGTTTACGAAATTCTGCCAAAGTCATCCACGTGCGATCCAATAGACGCTTCATGTCATACCCGCAGGAAACGTTT
GACTCCATCGTCGACTTCAAAGACGTGATATCAGTCTTGTTCAGTGAGCTGATTGTCTCTCCCAGCATGATGTTCTCCATGAAGTTCGTGAATTTGTCCC
AACTAGACACAATGTAATCGTCGTTCTTAATGATTTCCCCAAAAGCAACTCGGCAGTGGTAAGAACTCTGTCGGCGAGCTTGACATCGGTATGTCGATAA
CGACGTTGTCCGTTTGATGCAATATTGCGAGGATCTCGTCTTGCGAGGTCTCAGGATTGGACACCTTGATATACCGGGTATACTTGACCAGTGACTTAGT
TAAACCGAGCATGCTCTTGAAACACTTCACAGCCCTCTGCATTCCTTTCGCCAGTTTGTAGAAATTGCCAAACACACCCATCGTGGCGAAGGATAGTGTT
ATCTGGACCACTGTACCAACTTTAGTTGCGATTTCCAGTGCACAATCGTCGTTTTGTCGAATACACTCCAATCCGCACTCGACGGGGTACGAATAAGGAC
ACTGCGCCCAGCACATTCCGAGTTTGCTGTCGAATCCTAAGGGGCATGTCTTCGCAATGTGAGCTTCGCGGTAGCACGCTGAGGCAATCGAGGTATCGAG
TGCGGAACCGACCCAGTTGACGTAGGTAGCCTCGATCGTGCTGATAGCATTGAGTACGCTTCC