Description :
From Genome Similarity Track
Location :
Scaffold_199:118782- 122167
Sequence
3385 bases(100 bases per row)
GAGCGCGCGCAGTGGTCGCCGGGTACCGGTGACGTGGAGGCTGACGATGATCAGTCTCGAGTCGCCGGCGTAGTGGTGTTTATTGGTGTGTGCTTGGAGC
ACGTGAGGGCTCGAAGGTTGGGCTGCCACCGGAGGGCCCGGTCCTTCGTTAAAGCCAGTAGGGCGCCCCGCACCTTCTGGTCCTGACCGTTTTTTGAATG
AGCGACCGAGGCATATTCCGCATCGTCGTGAGAGACGACGGGAGCTGGCGCGTGGCACTCCGCCGCGTGGTGACCTTTCTTCCCACAGCGGAAGCAAATG
AGGGAACGATTGCTTCGCCCAGCGCTACCGCGGTAGGACCCGCGACGTCGATCGCTCGACGCGTTGATGGCGTCGATCTCCATGGACTCGGGGGTAGACT
CTCGGGCTTCCGCAGGTATGGCTGCGGTGTACGATGCAGCGACCATGTAATCCTCGCGAGTCGCGAGTGCAAATGCCTCCTCGGGAGAGGGGCGCTCGGC
TCTGGTGAGGCAGTAGCGGGTCATACCCTCACACATGCCGAACACGAATACGTAGACTTGCGAGACCATGTCGATTGGCTTGGTCACGATGCATGACGCC
AGATGTCGCGTCTTCTGGACGTAATCCCGCATCTTCCCTTGCCGAAGAGCTAAGAACTCTGCGCGAACGCGACGCGCAAGAGTTTTCAAAGTCGGGAAAG
CCTCGGGGTCGACAACCAGCTTCCCAAGGGCCCATTCTTTGGCCTTCCCGGTTAACGAGGAGAGGAGGAAGTTCATCTAGGCGGATGACGCCTCGATGCG
TCGCGAGGCAATAGCGATGTCGATCGCGCGGAACCACCAGTTTAGCGGGAGCCGGTTTTCACCGGCGCCAGAATACCTAGACGTCTTCATCTTGACGACG
TCATTCTGGGATGGACGCGAGGGAGTTGACACCCACCGATTCGCATCGGCGAACTCGCGTTCCATGAACTCTTGTGCTGCAAGACGTTGCTGGTCGGGCG
TCGCTGAGCTCAGCAGCGATGCGACGACAGCGTCTCCGGACACCGCCACGAGGCGGTGAAGCGCTTCCCACTCCACGCGGGTGAGAGGTGGGAATGCAGC
ATGCTCCAGGGTCGCCCCGGAGATCTGGACTTGGGTCATCGTAGACTTGGTCGTTGGAAGGACTACAAAGTGCTGTGTAACGGGGTAAGAGATACCGTCA
CTAGCTTACACTGTAGTGTGGAGGAAGCTCGCAATAGTAAAACCAAGTCTTAGGTTTGTGTCAAATTCAACTCTGATTTATTTAGGAACAGAGCGGCTAC
CCCTGGCCGCGTGTGAACCCGTGTGCCACTTTACCTACCTTTGTAATAACTAAAGAAATATCTACCTACTTATGTAATTGGAGCTGAGCCCATTACAAAT
ACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAGCCTTCACTTCTGGGTCCGAGAAGTAGAGCTGGCGATGGATGCGGCTCTGATCTCGACC
GAGCAACTTCGTGCTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGTGTTGGGTGTACACACGGGAGGCAACATCCCCTGGATGTTTCACATCCT
GGGCTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAGCTACGAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGCAAACAAGGGAGGCGTGA
ACTGCACGAGTACGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAGCTAACACATCAAGATGACTGTGTTCATGGACGGCCTT
CGAGTGGGATCCGCACGCACTCAGCTGTTCCGGGTGCAGTCCAACACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGGGTACAGCCATCGCCAGG
CGCGTACGCCGGTCTCTGCGTGGCCTGGGAGTTCCTTATCGGCTCCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACA
GCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAATCGTGACTGCCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTC
AAGGGTCGCTGGCAAAAGCCAGGATCCCGGGGACAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGG
GTGCGTGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAATCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGT
GTACGGAGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGATGCTCGTAGCAGCAACAAGTTGT
CCGATGCTTTGAGAAAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGT
CAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCC
TGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCG
CCCGCGAGGGCTGCCAGGGTACCAAGCATCCGGCAGATGCTTGGCAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTTATGGTGGCCGCGCCCAGA
AGAGGCGCCGGCCAGGTGGGTAACTTAGGTCCACAGGCGGGTACCTTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAG
TGGGTAACAGAGTTCCACTCAGGTCGCCCAGACCATAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCC
CAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACAT
CCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCAAAGGCGCCGCCGCCGCCTCAAGTCGGATTCGAACTACGTTCCGATCGACGTCGC
TTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACAACTTCGATGGCGAGACCGGTTTACCCGTCAAGGCA
TCTGGTGTCCACTTGAAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGTCGAGTCTTTCCTGGCCAACC