Description :
From Genome Similarity Track
Location :
Scaffold_2302:1187- 2698
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2302-fgenesh-gene-0.0Phospholipase D, Pi-sPLD-like-9

Sequence
1511 bases(100 bases per row)
AACGGCGGAGGTGTCTGGTGGCGCGGACTCTTCGTCAGCGGCGCCATTGTCCTCTGTCTCGAGTGAGAAGTCTTCTGCGCGGTGTTCTTCGCTGGCAGAC
TCACTGGTGGTTTGGTGGTCGTCGTCGCTGCCTGCCGCCTCGGTCATCACTTGCTTGGCTTGGCCATAGGCTTGCAGGACCTGCGAGTGAAGCTGGCACA
TCTCGGCGTCCCACCCACGTTGGGCAGACTGGTACTTTTCTGGGATGGCCATGAGTCTGGTAAACTGGAGTTGAACATCAAACGCCGCCTTCCAGTTCTG
CCACACATCGTTGTGGACGCGACGCCAGGCGACGTGCTGTGCCTGCTCAGCCGCCGCGGCAAACGGCTCATGTATCGCGACGGATGCAAGCAGCAACTTG
AGCTTGGCGAGATACATTGTGTAGAGCGACCCGACCGGAGCCCCCGTAGGCGGAGGCGGTGCCGTCAACCTGGGCACTTCTGCTGTCGCGGAATCCATGT
GTGGAGTTGGTTGGCGCGGTGGAAAGTCGGCAATTGAGGCTGAAGAGGAAGCACCGAAGAAGAAGAGACCGTTTGTGAGCCTACTGGATCGCACGGTTGG
CTTTGGTCCCACACTCGCTCTCGTTCGTCGGCAGAGAGGAAAAAAGAAAATCAACATAGATATAAGATATCCTCCCCCACGCTTTTCCCAGCAGATNNNN
NNNNNNAAGAGGAAAAAAAAGAACTTCAACATAGAAATAAGAAATCCTCCCCACGCTTTTCCCAGCAGATACTGTACTCTCACCGCACAACACTTGGCTC
GACTCGTAGCACAGTACCGTAGGACTCTAACAGAGCCTCTCAATTCATCATCATCACTGTACTCTCACCTGTCGCTTTCAGTTCATGGTGCTCCTACGCC
TCCACAGTCGCACGCCGCATTGCCCACAATGCACGGACACGAGCGACGGCAATGGCTCGAGGACGCTCATTTAGTTAGCCCCTGTTGTTGAGAGTGACTC
GATGGGCTGGGAATGATGGCTGTCAATGGATCCATGTGGACCACAGAAAATCTCATCTCAGCCTCGCACTGATTTTTCTTCTCCTGCTTCGTCAATCATG
GACGTTGCTCCTCACAGCTACAGTCTCCGATTCCACCAGCCTCACGAACGTCCGATCATCAACCTGACGACCTATGCGTCTGCACGCGGCCACCGGGTTT
ACTGCCGCGCTGTCGCTGTCGTTATGTGACGCGCGCNNNNNNNNNNACAGTCTCCGATTCCACTGGCCCCAACGACGTCCGACGATCAAGCTGACGACCT
ATGCGGACTCTGCACGCGGCCGCCGGGTTTACTGCCGCGCTGTTGCTGTCGTTATGTGACGCGCGCACCATTTCGCTGCGAATCACATTCCACCACGACG
CCCTGATAACCAAGAGTGCCACCGCTGAAGTCAATTGCACGGGCGTGGGCAATGCGTGGACCGCGCTGACGAACCAGTGTCTATGCAAGCCCTGCGACCG
CTGCAAGTTCA