Description :
From Genome Similarity Track
Location :
Scaffold_12:118690- 122882
Transcript NameFunction/comments
Albla_Nc14016680double stranded RNA binding putative
Albla_Nc14016690PREDICTEDx3a similar to cop9 complex subunit 7a putat
Albla_Nc14016700conserved hypothetical protein
Albla_Nc14016710conserved hypothetical protein

Sequence
4192 bases(100 bases per row)
TTTGATCAGTGCCAACGAATGTTCAGCCCGTCGTAACGCACGCTCATCCCGTATTAAACAGCAAGCTCTTACACATACTTTACATCATCATCTATCGCTT
CGTATAGATTAGTCAATATAGAACACTATAGACTATTGATGATGACAAACGCCCCTCGTTTGTATTCGGTAGAAAAAGTTGGCCACGAAAACGCTAGCAA
AGTTACTAATCCAGTTGACGAAAGCGGTCATGTTTTTGGTAATTTTCCCGCCTATTACAGCTTCAATCCCGTGAGTGAACGTTTGCGCTTCTTAAATCAT
GCTACTATTCAAGCATTGCAAAGTCATCTATTGCAAATCCCCGAACAAGACGCGGGAAACCCTGCCGTGCTGCTGGATGTTGGTTGTAACGAAGGTTCGA
CATATCTTCTATAAAAAGCCGTGTAGTTTACTGAAGCATCACAACTAGGCAACTTGACCATTGCGCTGTATCGAAGATTAGTAGGAATAGACGAGTTTTC
TGAGTCGCCTTGCGAAAGTGGAACAGAAAGCTTTGATGTGTCGTATGTTAGCAAATTGAATGATCTTATTCAGCGGCAGAAAATCAATATTTGTTTCCAA
TTTGAAACTAAGGAAGATGAAAGAGGTCAAAAATGGTATCACTGTAGAGTCGACGAAAACGGCCAGGCTCTAGCACACGGAAAGGGGATTTCTAAGCGAG
TGGCGAAAGCCCTGGCTGCTCAAAGCGCCTTGTCGTTGTTGACGAATAATGAGCAGAAAGTTTCTCTGGTATCTGCAAAAAAGATGGAAGCACAAGAAGA
GAAAACTCGACGGCGTTTGATGGTGATTGGAGTAGATATCGATCCCAAATTAATCAAGAAGGCCACAATGAAAACTGTAGAAGTAGAGGGCGATGACGTC
CTCAGATTTATGACAGGGGATCTCGTTGACCCGATCGTGTCAAACAGATTACTGGAAAGCTTTTATCGGGAAAACTGCAACGGTCTTAAGGATACCAAAC
TTCGATTCACACTAGTGACGTGTTTTAGTGTGCTGATGTGGATTCATATCAACCATGGTGATGATGGTTTACGAAAAGTTTTACAATATTTGTCCGATTC
AACTGATCATCTGCTTCTCGAGGTGCAGAATTGGAAATGCTACAGGTGATGCTAGCAACAATAATCATTGTGAGATTAATCCGTTCAGTGACACACAGGC
GAGCTGAAAAGAGATTGAAGCGTCTTGGGCAAATTGTTCCTAAAAGCTTCTACAGGATTCAAATGAGGCACAACATTCTTGAGGGCATTGAGCATCACTT
GCTTGCTCCGAATGGTCATTTCAGGTATCGAAAGATCCTTGGGGTTACGCAATGGGATCGTCCAGTCATCTTATTCAGCAAAAATCAAATCCCATCTATT
GAATACAATGGGTGAATAGATTCTTTCATATTTGGCATCTGAACGTTAGCACATCCTACGAAGCGCTACTGAGAAGGTATGCAGACTTGAGCTAGAGTGG
CAAAAGTAAGGTTGATTGTACCAGCACAGAGCAGGCAATTATTATTATATTATCGCGATTGTGCAGTAAGTTTTCGGTAATCGTCATGCTTGATGTCGTC
ATTTTTCTTGCTATAATCATGACTTCCGTCTCTCTCCAAAAACGATCGAGAGAAGCCGATATCAGCATTGATCAAATAAGGCAGCTTTACACACGTTTGC
GAGCCATCGGTCCTTGAGATCTTTGTTTCATTGAGCTGCAAATGTCATCATAACATCAGCTTTCTGGCAGTAATGGGAATAAGATACCTTGACTTTCGTG
ACCCAGGACTAGATTCGCCAGTCGCATCGTCCACATGCATTCGATTACCATTTCCCTTACTTCGCTCCATCGTGGCCTTAATCTTAGACTGTATTCTCTC
TTCTCGTGCAACATTGTCACCCACGGTTTTTGTAGCATGGCTATCAGAATATATGAAATTTGGTGACAAATGAGATCTGAGGCCAAACCTCAAAATAGAG
TCGATTTTATCACAAACTGCAAAGGCTTTCAATTGCCTACAACGAGTATTATCAAGCGTACTGTCTATACAATACGAAGCGGCGAGCCATATCGTACCAT
TCTTTCAATTTGTCTTTCATAGAAACTATATCGTGGCTTTGAACATCCCGTGCAACCACGTAAGTAACGCGTATACTCCTTGTCTTCTGATCTAGTTTTC
CTTGTACTAGCCCCTTCCAGTACAGCCCGACTTTATCATCCATTCTCATTCTTGAAAATTTTTATATTTACCGAGTAAATTGCATCTATCAGAACGTCTT
CTAGCGCTCTTATTGTATGAACATCCAAAGCACCCATCAGTACTTCATACGATAGATCCTGTTCATCACAAGTTGGGAAAGCAGTGTTGCAATATACAAA
AATTCAGCACTATCTGGTAGTGTTAATTCAAAACATCCACCAACCTTTCTGTGTTGTGCCAAGGACACCACGGAAAGCTTGCGCAGTTTGAGTTCCGAAG
CAGGATTCAGCTCTGGAAGTTGTTGCCGTTCACCTTGTATTATCAAGGTAAGAATATGAGTGCAAGTAGGTATCGAATTTATCTCCTACGATTATAGTCG
TTATAAGTCCCAAACGCAAAAATCTGAAGAAGCCTGTACGATGATTGGAATTCTGTATTCTCCAATGCAGCGATATTGGGCATCACAAGTAGCTGGCTAA
ACAAGAATACATCTGGATTCGACAGTACTTGATGGATCAGAGCTTCACATGCTCTTCCTCGAGCATTTTTTGCAAGCAACGTGAATTGTTCAAGGCTAGA
ATCGGTTGTAGCACAAAGGAATGTCATGCCAAATTGGGCAGTGTGATTGGGTGTTTAATTATCAATCAAGATAAATTATCGAATATGGACGCAGAAATCG
AGCAAGAAGTCAACAGTGGATTAGCCAACGCATTGAAAGTACCAATTTACGCAGCAAAAAAGCAGCATTACGAAATTCTAAAAAGTATAATAGAAGGAGT
TGATGTATTGTGCAACAGCGCCACGTATCTCAAGTATATACCTGACGAGCCCAACGTGTTCAACGTGTACGAAGAAGTTAGTAAAGAGTATGCATCGTTG
GGACATCAGGTCGCTGTCTACAAAGCTCAAGTTGAAAAAATAGAGATGTTACTAGAGCAAGGAACACTGGTACGTGATTAATTGAAGATCGGCATTTTTC
CTTGGTGAAATCGAGTATAGGACACTGAAGAGATCGATGAGATATTGCGAGAATCACTTCAAACCCCACAATACTCCATGGAGGAGCATGAATTTCATCG
AAAGTTTCGTAACGCAGCAGGCGTACGTAGTTTAGCTCCTCCTTACTATTCTATTTTGTAACGGGATAAGCATTGTGCTGTCAGATTGGCTCTGATGATG
AAGATGATGAAGTGACATTTCAAAATACTGAAAGTGTGAGAAGCATCACGTGTCCGGTGACACAGATGGATATCGTCAACCCTTTGCGAAAGTATGTAGC
TCGTTACAGTGCATGGCATATTGGTACCAAGAACAAATTCTGCGTGATAGTGCCGCCTGCGGTCATACTTACTCAGAGCAAGGTATTCGTGCACATTTAA
AGCGAAACAAAAAATGCCCAGTAGCTGGGTGCCAAGCAGTAATTCAAGATGAAGAACTTGAGCGCGATGTAGAGATGGAAGTTATTATCTCTCGAACGTA
TGCTATCTGCACGCGCGCATCACATTAACTCTAATGATGACTTGTGTAGGAAAAATTCACAAGGTTCATAGCTACAGTTCAAACGTGGCTTTCAGAGCTG
CCATTATGGACAATAAGAGATGCACTGTAAGTGGTTACATGGTCAATCTTCAAACAGCCACTTGTTATTTCGCTTTTGTTTCTTCGCTTTTTTCTCAGCG
TTGACTTTTTTCCAGTCGATATTTTTTCGCTTCAACTGCTCCTTTATCAAAACTGATTTCTTGCGATTTTCTTCCAGCTGGCTTATGTCAAAAAATTGAC
TCATTTGCCGACCTGCACGATCAGGTGCGATCCCGACAGCATCCCAGTAGTCCTGGCCGCCAAATTTTTCATATTTTCCGGTCACACGATTCAGCTTACC
AACGGTGGTGTAATGTACTCCGTCCACGAGCTCTTCCTTTTTGGCGCATTTGTGTTCGAATGCTTCTGCAGGTATCCAGTCTGCCAACTAGA