Description :
From Genome Similarity Track
Location :
Scaffold_57:11869- 13022
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014040Similar to lpxA: Acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase (Bartonella henselae)

Sequence
1153 bases(100 bases per row)
GATAACCGCGGCTCGGCGCCATGGATCCATCCGACAGCCATCGTGCATCCGAGCGCGGCGATTGGTCACAACGCGCACATTGGTCCCTACAGCATCATCG
GACCAGGTGCGTGGTCACAAGCAGAGCCATTTAGTTGTAATTGTCGCTCTAACTCGCGGTTGCTTCTTGCATTCTCTAGACGTGGAGCTGGAGGATGGCG
TGTTCCTGCAGGCACATGTCATCGTCGAGGGCAAGACGCGGATCGGACGCGACACGGTTATCCACCCGTTTGCGTGCATCGGTGGTGAACCGCAGGACAA
GAAGCATGCGCGTCAGGGCTCCAACAGTAGCTCCTCGACCTCTTCGCTCGTCATCGGCGACAACTGCATCATCCGCGAGCACGTGACGATCCATGGGAGC
ACGTCGTATACTTTGGACACGCCGACGACTGTGGGCAACGACTGCTGGATCCTGTGTGGCGCGCATATCGGCCACGACTGCAGCGTCGGCAATCGCGTCG
TGCTCTCCAACAACGTGTGCGTCGCTGGTCACGTCGAGATTGGCGACTTTGCGATCATCGGTGGTCAAGTCGGACTCAAGCAGCACATCAAGATTGGCAC
TCTCGCAATGATTGGCGGCAAAAGTGCGGTTGACGGTGACGTGCTGCCGTATGGGCTGGCGATCGGCAACCGCGCCAAGATCGCAGGACTCAACCTGATT
GGACTCCGACGCGCCAAGGTCTCGCGACAGGACATCAAGCTGATGCTGCGCATGTACCGGTATATGTTTGGCGTGCCCAGCTGCAACAAGACTGCGTTCG
CGCCTGCACTAGAGTACGCCCATGTTTATCGCATTTTCTGCTGCTTAACTTTCGGGGTTCAACGTCTAATGCGGTGTCTGTTTGATGTACATATGCAGCT
TGGCTGCAAAAGAATCGATCGTGCTGCGCGCCGAAGAAGTGAAAACGTACTTGCTGGATCAGCAAGTTGATTCGGCAACCCACCCCATGGTTCACGAAAT
GGTATGTAAGCCTGTATATTTTATGCGGCTTTCATAATGCGCGCGATTAGGCGCAAAGCCGTTTTCAACGTGGAATGTATGTTTGTGTGCATATGTTCAG
GTGGACTTTGTGTTGGATTCTCCAAATCGTTTTCGATCGTCCATGTGCGCTGC