Description :
From Genome Similarity Track
Location :
Scaffold_654:11866- 14380
Transcript NameFunction/comments
Phypl_g10102hypothetical protein

Sequence
2514 bases(100 bases per row)
TGAGTCGAGACTGGTTCTTGTACATGACAGACGAGAAGATATTCACTCTAAGACGAGTCCCTCAAGAACACAGTGATGCAGCTATTCATTTCCAGAAGGC
TATGGAAGATTATTTTGGGAGCCTGCTATACAAACACCTCCTGATCTGGATTGACGGCCTCCTGCTGTACGCAGATGATAATATCATCTATGGACTGTCC
ATATTATGGACACCTCCTTTGACAAGCTCGCTGAGTTCTTATCACTGCTGGACCAGTTTGGGCTCAAGTtgagcgccaagaagacgagccTCCACCATGC
TGAAGTAAAGCTATGTGGTCGCCTCACCAATGGCGACGGAGCCAGACACGGCCCCGAGCGGATTGATACTCTTCGTACCATGCTGTACCCCTCAACGGCT
GGTGAGGTACAGCAATTTGTCTGCGTGATAAACTGGATGCAGGAAAGCATCGTGGATTTCGCTCGCCAAGTTGTTCCTCTTCAGCGCCGACTTGACGCCG
CACTAGCTAGCACCAAGCGAACGAAGTAGGCTGCGGCTGGGGTCAAGATCGTGTTAACGCAGGACGAACGGGTCACCTACGACCAAGTGAAGGCGATGTT
GGCGACCACAGCAACCCTGACATTCACAGATGATGAAGCAATAACATGTCTCTTTGTTGATGCCAGCGACATCGGATGGGCATTGATAGTGACTCAAGTT
GTGAATTTCGACTCGAAGATTCtggtgacgaagaagcagcaaaatcTTCTCACCTACATGAGTGGCACCTGCACAGGAAGCCAGATCAACTGGACGGTCA
GTGATAAGAAGGCTCTGGCGATAGTCGTTGTTGCGTGTGAAACGCTCGATTACCTCCTACTCCGGTCCAAACCTTTTCGAATGCTCTGCTACCATCTAAA
TCTGGTTCATGTGTCTTCGCGCGACGAGAGTGTGAAGAAGCGTGTGAAGGGCAAACGACTAAGATGGTCTATGAAGTTCACGGGTTTCAGGTACATTGTG
GAACATGTACCTGGACCGGACAATGTGTGGGCTGACATGGCCTCACGGTGGGCCGGCAACCACGTGCCAAAGTTGACCGTGAAGCGACTCAAAGCGATCC
GACATCGCCGTCGAAGTCGTTCGTCGACGCGTCCCGCTCTCCGACCGCTAGCCGCCGACAGTTTTGTTTGGCCGGCTTTTGCAGAGTTACCGGAAACCCA
GTCCAAGTACCCGTCGTCAGCCAGTGCTGTGCGCGCGGACAAAGGCGTTCTCACCGCCGACAACCCTGTTTGGGTGCCAGGAGAAGCAACTGAGTTGATT
CAGCGGCTGTGTATTGTGTCTCACTGTGGAGCACAAGGCCACCGTGACCAATAAGCCATGGTAGCTCACCTTCAACGTTTTTTGCGACCGACAACCGTCG
GTACACCGTGGTGACATTCGTGAAAAATGGTTTGCTTTGTCTGCATTCCCGAAGGCGAAATTATCCCGAGGCCGTCGGAAAAGGTGATTGACTGCAGTCA
ACGCAATGGAGTTTTTCATTTTGATTTCCTGTAGATAGGCCCGAGCTACGGATCCAGCAACTGCCTGCTGGCTTTGAAAGACCACGCCACCCACTATTGT
GAACTAGTGGTGGCAAATTCGGTTGACAGTCCAGTGGTCGTTGAAGCACGGCTGGCATGGCATTCTCGTTTCGGAATACCGCCTTCGTGGGTATCCGATC
AAAGTACACATTTCAAGAATCAAGTCGTGGCAGAGCTGAGTCGACGGCTCCGCACGCAACAGTCTTTCCCACCGGCGTACAGCCCGTGGGTGAACGGTGT
GTGATCGAGCGCATCAACCGTGTCATACTCCAGGTCATCCGTGCCATGATCCCGGAGTACAAGATCAGCTACAAGTTTTGGGTATACCTTGTACCGCTGG
TGCAGTCTACCCTGGACCATACTGCAGTGCCTTCACTGGGCAACCACTCACCATTCAAGATATTCATAGGGTTGGAATGTCCGACGACGCTAAGTGAATT
ATATATGCCTGACAACCGTCATCTGCAAGCAATTCATGTCAGTGCCTAGATCGAGGGCTACGTAGCCGAACTACGAGAATGTATCCAATCAATGCACTGT
GCAGTGGAGGACCTGCGACTGAAGCAGAGACGCCTGAATAAGAAGCGTGAACGTGGTGACAACTTGGTGAACTTTGGCGTGTGTGATCTTGTTCTCCGTT
CCAGAGTGGATGACAAGCATGGCAACAAGTTGCCGATTATGTGGATTGGCCCGTACCGAGTGACTCGAGCCGATACACACTCTTTTCGAGTGCAGAACTT
GGTGACTGGCGAAGGGCTGGACGAGCACGCATCGAGACTAAAGTTCTACTCCGACGATAACCTGTGTGTGACGGACAAGCTCCTGGAGCGCGAGGTATCG
TTCTAGCTGTTGGCAAGCTAAAGGAACACAAGTGGAACAGTGACATCAACGACTTTGAGATTCTTGTCGGCTGGAAGGGTCTGCAACCTATCGAGGGCTC
GTACGAAGCTATGA