Description :
From Genome Similarity Track
Location :
Scaffold_419:118634- 124396
Transcript NameFunction/comments
Aphin_H310_00870Hypothetical protein
Aphin_H310_00871Hypothetical protein
Aphin_H310_00872PREDICTED: RING-H2 finger protein ATL44-like
Aphin_H310_00873Hypothetical protein

Sequence
5762 bases(100 bases per row)
TGTTTGGCCGGACTACATTTTGGCTGACCACACGATTTGACGCCAATCTTTATCCGGATACAAGGCATAATACGGATTTCCGGATGCCGGTGCGATCTCA
ACACATGAGCAGCATGGCGGCAACCCAACCGCCACTGCCACCGCCGCCTCCGTTGCCGCCACTTCCACTGGATGTCGTGCTCAATACCGAGCTTCCGCTT
GTGCCTCCCGATGATTCCAAGCAGTCCCAAGCTTTGACGTCCATGCTAACGTCCTTTGCACATCCTGCTGTTGTTGTGGGTGTCATTGGCGACAGTCCCA
GTGCGGTGACCCACTTTGCCAACCGCCTTCTCGGGCGACAGGCATTCACAACTGTCGAAGGGCCGTCCATCAACATCCGAATGTTCTATGATATCGAGAA
GAAGATGATTCTCCTCCTCGGCCTCTGCTATCGGAGGTCGGCGCCTCCATCGTCAGTCTCGGCGAATGAAGTTCACGATGCGTCAGTCCACTCCCTCCGC
GATCAATTGCAGATGCAATTGCTCATGTTCTCTAGTTCCCACGTTCTCTTTATTGTTCACGATCACGCGCGAGTGAGCACTTCCCAAACACAGACCTTTC
GATCGCTCTCGAATGCGAAGCACCAACTCCTCCACTTGCTCAAGCAAAAGCCATCTTCCAAGCATGCGAGCAAGGCATCCTCCATCCTTTCTTCGTCGCA
TTTCGCTCCAGGTCGTTGTGTGCCCCTCGCGACGTTTGTTTTTCCCGTGGATGGTGGGCGGAAACTGTCGCGATCGCAAACGACAACATTCTGCAAAGCC
ATCGAAACTCGACTCCATGCCATCCTCAAGCCCCTTCGCGGCGGCACAATCGCGACAGTTCGCGCCAAAGACTCAGTCGCTGCCAACAACACCAATAAGG
AGCGGCGCCTGTTTGTCCTGGACCCTACGCACGAAGTAATGGCCGTTCCCAGGAAGCTCGCCACAGACGACTGCTGCCTTCTCGGTCGGATGGCTGCCGT
TCTAAATAGCATCGACATCGCAGCTTCCGCGCCAGCCATGGACTTGAAGCATGTGCTCAAGCCACTTGACGACGAAGACTCTATTGCCATGCCACATGCT
ATTCAGTTCGCGTCGAAGTGCATCGACCTCTTTGCCCACGACGGTACATCTTTTGCGTGTTTTACCAGCGGAAACTTGACTTTCCGCCGCTTTGTGACGC
AAAACTGAAGTTGTGTGTAGCCGTGAGGAAAGACCTTCTCCCTCTCGATCAGTGGATCGAACATTTCAAAGCTCTCGCCGCATTCGTCGTGACAGACAAC
TCGATATTTTGCTCGCCCGATGCCGCGCCACTAAATGTCCTCCCAATGGACGACTTGTACATCCACGGTGATTCTTATTCTGATAGCCATCTCACGTTGA
TGCAAGCGGTGGACACGGTTGGGACGTTTGCCCAAGACCAATGCATTCGGGTACCGGCGTATACCTTTTTCACGAAGCGTGCTACCTGTCGTTGATGCTT
AGGAAAGCACCGCGGCTGTCAAGCGGTACAAGGCAGAGAAACCCGAAAAGATCAACCGTCACGTCCACGACAGCAGAGTGCAGCGCACAGTCGCCGCCTT
CCACCGCAACGTCGGCAAATCCAACCCATTCGTCCAAGTACGTCCCCATGCAGCACGTCTCTGGCGCTCCATGTCATCCTGTTTTGCAGAAATACACCCA
AGATATCATCGACGCTTGCAGCACGATTTGGCATCAAAGTCGGCGGCTTTGTGATGCCATCAGTGTTTCGGTGGGTTTCTTTCTCGTGGAGGTTCAGTAC
CTTCTCATGATTTGTTGTCGCGGGCAGAATCGACCGTGCGCTCTGCTCTTTCATGACCCGGACGGCGTCCGCCACAACAGTGGATGTTGCTTGAACGTCG
CTTGTGTGTGTGGTGCATCCGTCACCCGCATTCCCGACCCCTTTTTCATTGACGTACGACGGAATTTTGTTTTCATTGGGACATCACGGTCGTGTAGGCG
AATCGGCGGGACTTGTGGACCATGCCATGCTGCGCCCAGCGAGATCCATCGCTCCAGGTACAAGAACGACGTATTGGCTGTGACCCTTTATCCAACACTA
GAGCCAACGCGACTTGCCCGTCCTTGTGCGCCTCGGCACGTTTGAGGCGTACGATCCGTTTCAGGGATTTGTCATGACCCCTGGCTTTATCTCGAAGCTC
AGTTTGCTGTCGCCATGGCTACGCTCGGCCCCTTCCGAGAGCGTCGTTGGGGTGCCCCAAGCAACAGCTCCTCGACGTCGACGGCACTCCCTTCGAAAAC
CCCATACGAAACAGCCGCCTGACGTCGCCCAGTCCGTCGACTGCGGCCCTCACTTGCTCATTGCCAACGTGGGTCTCGAATACGAATGTGCAGCAGGCCA
TCGATTTTTCTTCCCACCGCCACAACATTCCCAGCCCCTCTCGACTGTGGTCGTCTCCGGAAACAACGACGACGCGGTAGGGTTCTTCGGCTCTCTTGAT
GATAACATTGTGGTAGGTCTGGCCTGGTTGTGAGATGACCATCTACGTTCAGTGCTTCCACTGCTCTGGGCCTAAGTCTGGTCCCCACAAGCCTCAGTCA
GCATTTGCCCAGTTGCGCCGTGTCTACGCTGCAATCCCGCCTCCTCCGACATGCGATCCCCACGGCGTGGTTTCGTTGAAAGTTGTCGTGAAAGTACGTG
CCGGCTCTGATAGTGTTGTAAAGCTGCCGTTCTAGACGGAAGACCAAGACGTGGTGTTGTCCAGCCAAATGGACCACCTCGCTCCCGATAGCTTGTTTTG
TTTTACGCTGCCGTACGTGTTTTCCACACCGTCAGGTTCACCGATTCGCCACGGTGACGCGCTCAAGCTGCACACCGGAGTCGTGACGTACAAGAGCCTG
TCGTCGACATGAGAACGTGAACGATCGAACGCTGAAGGCGGGCCCTTTTTAAGATATGCAGCGATCCCGTAGAAATATCCATGGCTCGCATGCACTTTGT
TGTCCTTTGGCGTCCTCGACAACAACCAACTAGTGGGGGTGGGGGTGGTATTAATCGAAGCGACAGCGCTGGGACGTGGTGCAGATGGCAGGCACGTCAA
AGAGGGTTCTGTCCTGGGGACCCAACGAAAAGTTTGTAAAGACCATGGACATCATTTTCCCAGCCGCGATGCGTCGGCCTGTGGGGGATTTCGGGATGTA
GTCCCACCTCAAGGGCAGGCCGTCAGAGTTGAGCCAGAACATGCTCGCCTGCTCGGGGTCGACCCTAAAAGCACACGCTGTGCACATGACATGCCTCAGT
GCACGAAGGACATTACCACAAAGTCGCCATGGCCGTATCGAACGCGGCATTCCCGACGGCGCGGTAGTTGTAAAACGAGGTCGGCCGCAGCAAAATTTCG
TCGCCCGAGTCCATGAAGCGGCAGCATTCGCCATTACTTCGAATCAAAAACGCGTTTGCATCCACAGATACGATCTTTCCCGTGACGCCTCGGCCAAACA
AGTTAGTGTGATCGCTTCGGTAGGAACGACCATCCCCTGATACGTACGCCAGACCATCGTCGTCCGCCGACAGAGTGTACTGGTGGAACGAGCAGTCCAA
TGGAAATGACACGTGATCGTACACGTCAAGTTTCGTAGTAGCGCCGGTGGGCGCGGAATCATGGGACAGTGTTGCGATGCTGGCAAACGCCGAGGCAGCC
CCCCACTGAACGCCACCGACGAGGCAAACGACAACGAGGCAAGTGGTCATCGCGATCATTCCATGAGCGTGCGTTCGATGTCCAACGGTGGTTTGGACCT
GTGGGGCGGCTAGTGTTGTGGAGCGGGGAAGGAGTCGCTGTGTCTCGGCTGGGGAACGCGTCATACTACTGCCTCCTCCGTTGTTGGCGATGATGAATTA
GGATACAAATATTGCCAAGACATCTTGAACGCGGTGATCTTACCGGATACTATCCGGATATCGATCGCGATCCCTCCCTAATTTGATGCAATCCAGCAAC
GTGATTGGTCCACGATGACCATCAGATTGGAAATTGGCCAATCCGATTGGTGGATTTTACACCACAAAAGAGTCCACCAAGTTGAATTTGAGCATTGAGA
AATTCAATCGGGCATGAAGTGGGTCCAAGAACAGTTGAGCCAATGCGTGGCGGGGCAGAATGGCAACGTACGGCGCCGGTCGTCGCGATAGGTTGCGCTA
ATGGCATTGGTGACTAGTCAAAGTGGGACAAGCGCGCGGCCTCGTACTGGAGCGAAGACACGGAAACAGCAAAAGCTTTGGCTGAAGAGCTTGGGCACAG
CGATGACGACACCAACGACTTTGTGCGGTGTGTCAAGAAGAACCTCGCTGTGGAACTCACGCCCAAGATTGCATTGCCGAATGTGATGAAGCACACGACA
TCGACGGCACGTGACCGCACAGTGCCCGTGGAACCGACGGTGACAATGGACGAAATCGTTTCGGACGACTCCAAGATTCAGCCATTGGCGCCTGGATTGA
TCTCGGTGGCGTCTTGCGATACTGACCTTCAAGAAAGCCTTGCTTTGAAGCTCATGCGATTCGATCCGTCGAAGGCAACGAGGTATGACGCAGTCGTACG
ACGGCATCTCTCACGCGTATGTTGAAGTCCCGTACTCCAACCACATTCATCGACCAACTTGGTATTCTTGGCACTTCAAAGTCACAGTGCTTGAATACTA
AATGCATAGCGCTTTTTATCACTTCTTCGAAATGTGCGGCGCTTGGAGTCCCAATATGCCGAGGTAGGAGTTGTCCGTTCCGTCGTGCCAATTGAGCAAG
ACGGCGTAGTCGGGGAAGCACGGCCGAATGCTCGCATCGACCATTGTCGAGCTACCATCGTTCACGTATACCTCGCCCGTAGACGCATCGGCAGACCACG
GTACCAAACGGTAACACCGACATCTCTCTCCACTTTGATTGAATCATGTGCTGCAGGTGCGCCATTTGCCTGAGTGACTTCTCCGACGCCCAAGAGATTC
GCGTCCTCCCGTGCTTCCACACGTATCATTCGTGGTGCATTGACAAGTGGTTGCTCAACCACGCCAAGTGCCCCGTGTGCATTTTGAGTCCGTAAGCGTC
TCCAGCACGACATCCAGTATGCTAGATCAACATGCACTGGAGTTTGTTGCCACTGTGGTTAGTCGATTCATCTAGGGGCGGTCGACATGCATAGATGAAG
GGGATGGCGATATCCCGGTTGCCCGATGGTTGGCAACCAGGACAATGACGGCTTTGGCACCGCCATCCTTCGCATTCGAGTGAACGAGTCCCTGCTGTCA
CTGTCCGCTTGAGACGACGAAAGGGCCGACGAGGGGTGCTGTAGCAAGTACATTCCGATTACCCTAACTACTTCGCTGTGTTTGCCGCCCCGACGCCCGC
AACGTGGGTGCACTACTCACACTGAGGCTCGTGGACGAGGCAAAGCTACTGCTATTGTTGTGGCCTTGGCTGTAGGTTGAGTACCGCCGGAGGTCGGCCA
GTTCTTGCGCCTGGCGCTCTAACCGCATGTCCATCTTGCCCATCTCTTCCCACGCGTCTTTGACAACATCTTCGGTCACCGTCATCTTGATAGCGGCAAC
GCTAATTAAATATTTCGCTTGCTCCAGTTGGTTCCCTTGGTCTGCCACAACCGCACGTAGCTTTTGGATCGTGTCGACGAGTGCTTCGCCGTGGTTGTTA
TCGTCGTCTGTGTCAACGTCGAAGTCGGACGTCATCAAGCTGGGGTCTCGCCCATGGAACGT