Description :
From Genome Similarity Track
Location :
Scaffold_648:11863- 13266
Transcript NameFunction/comments
g7079.t1ETI35041.1 hypothetical protein F443_18564 [Phytophthora parasitica P1569
g7080.t1hypothetical protein

Sequence
1403 bases(100 bases per row)
TCTACGCGTGCGTCTGCTGGAGGCGGCGCAGTGATCGCTGGAGCGGGGGGGTCGGGTGCTGTGGGGTCGACGGAACAGTGATGATCAATGTGGTGCACAT
GCACTTGGGATCGAAGTGCCTATGTGGTACACATGTATTTTCAAGTAAAGATCATGTGTGGTGCACACGCATTATAGAGGCGCTGTGCACGGTGCTACCA
GGATGGGCGAGTGGGGGCAGCCGGGCTGGGGGGCGTCTGAGCCTGCGTATTGTAGGGGATGCTTTACTGTGCTGGTCAGATTCCTACGTGTGTTTGCTAT
ATTTCCTCGGTCCGGTGCTCTAAAAAGCCAGTGTAGCGGCTGTTTCCTTCAACAAGACGACAAGATAAATTCTGGGAGCGGTGAAAAGCATTCTCCGACG
TGTTGTGCACACGAACTCTAAATCTCAAATTTTGTAAAGTTGGAAACGAGTGGCATTCGTCGTTCGGTCCCCTCGAGAGGAACCGGTAAAAGCGGCGCGG
ATCGCTGAAGCTCTTTGGACACCTGCGACCCGGCGTGATGGTACGTGACCGTGACCCTTGCTTAGGCGTGTGTATTTAAGCGGGCTTCATGGTAACTGTC
TCTGATTTTCATTCGTAAACAGCCAGATCTCCCGCCATTTCCCGCCCGCCGCAAGAATGACGTGCCATCGAGACTACTGGTGCAGTCGACTCTTCCAGAC
GCGGACCGACTGATAACTGAGCGTGCTGCTGCGGAGGAGAAGAAGCGCGCGCGGACATTGTCGCTCGTCGCCGACAGCGCGTGGCAGACATTCGATCGGG
GAAGAACATCCCCCCTTTTCCCGCCCCATATCAAGCGGCTTTTGAGGCTTTGCGTGCGGAGCGTATCGCGCTCGAGAAGAAGAAGGCTGTTGAAGGACAG
TTGGAGTCACTGGGTCGTACCATGCGAACTCGAGCGTCGGACGCGAAACTGCAAAAGAATGAAGAAGCTGAGAATGCGCTTGGCGAGGTGATGCAGCAGT
TGGGCGCCGAAGACAAAGAAGGCGAGCCGTCGGATAGTGGAGACTCCGACTACGAGGACGAAGGTGCCGGTGCCGCGCGGCCAGCCAAAACCTCTAAAGG
TATCGTGCTGCGTGGATATGCGGATGAGGACAGTGTTGCGAGTGAAGGTGTCGATGACAGTGACGAGGATGCAGAGACCGAGGCGGGAAGCAGCAGTGGC
AAGGACGCAGAGGAGATGGAGGTTAGCAGTAGCAATGAAGAATCTGCGTTCAGTGTCTCACAGAAACGAAACCGGAAGGGACACCGGAAATCTCCGCGGA
AGGCAGCACGCACGGCGACAACACTTTCGCCTCGTGACGGAAGTGATGCTGAAGATGGTGCGTTTGTGGAAGGTTTCCCGTGTCGCTGGCCATCGTGGGA
GGA