Description :
From Genome Similarity Track
Location :
Scaffold_159:118627- 119631
Transcript NameFunction/comments
Hyaar_Emoy2811511hypothetical protein

Sequence
1004 bases(100 bases per row)
GGTGTTGAATAAAGCAAAAATATAAAAAATAGCACCTTATTGCGAACCCGTAGGGTGAAGCTATTAGTAACTGTGCGGAAGGTACATGCCGAACTTTTTA
AATTGTACTTGTCTTCCTGTCTGTCTGTAAATATCACTATGTACCGTATGTGTCGTATTAAGCGCGATTTGATCTTTTACCGTCATTGTAACGCTAGGTG
TACCTTACACGTCGTACGAAGTACGAAGTAGCCTGTCCCCTTCTTCGTATGTGTCCATAATAAATGCTAGGTGTACAATTCATATCGTATTAAGTGCGAT
GCAGCCTGTCGACTCCTTTCCATGTGTCTGCAAATAAACGCGAGGTATATCTTACACGTCGTACTAAGTACGATGCTAGCATTTATCCCCTCTGCATTGA
TAATAGGCATTGTTTCGAACCCGAATAGCGAAGCTATTAATGACTGAGCGCAAGGTTCGCGAATATACCCAGCTTGATTCAGTTCTATGGACTTACTTAC
TTAATCCAAGGGCGAGCTTGCTCCTCTATCTTATACGTTCTATGTAGTGCTAGAGTTTGAATACAAAGGGTAATAACTGGCTTGACAATAAGGTTATTAA
TGTCAGGTTTGGCAAAAAGAGTGTGAATATCAGGTTTGACGAAAGGTGTGAATAAAGGAAGAGGGGTGTAATTATATCAACTCCTTAAAAATACCCCAGA
TCATTGGAATTCTAAAAAATGCCCTAGATAGTTGAAAAAATAAAAATGACCCAGATAATTGGAAAATAAAAATTCTCCACGTCCTAGTTTGCTCATGTTT
ATGTGGCACACATAAAGACCCACGTCTTTAGTCATTTCCCAATACTGTAGAACCCCTCTTAGCGAATCCCTATTAGCCAATAACCCCTTATAGTCAATGA
CAAAATTTCGGCCCGACGTTGGGCAAGAGAGATTAGCTAATAACCCGTCTTTCTTAATACTTAATGAAATTTAACAGGCTCTAGTTTTTAGCAGTTAGTA
TTTT