Description :
From Genome Similarity Track
Location :
Scaffold_117:1186- 2756
Transcript NameFunction/comments
Phyra_40264succinate semialdehyde dehydrogenase putative

Sequence
1570 bases(100 bases per row)
AGCCCACCAATGCACACCATCTTGGACTCGAGATACTCTTCAAGACCTTCGGGCGAGCCCTCGCGGCCGATTCCAGACTCCTTCACGCCTCCGAACGGGG
CTTGCACGATCGAGACCACCCCCGCGTTAACTGCCACCATCCCGCTTTCCAACTCGCTCGCAACTCGAAAAATGCGAGACACGTCCTGGGTGTAGAAGTA
CCCTGCCAGCCCGACATCCGTGTCGTTCGCCTTGCGAACCACCTCTTCCTCGCTCGAAAACGGGAAAAGAGGCACCACCGGACCAAAAATCTCCTCGTTC
CAGATTCGCATCTTCTCGTTCACGTTGGTGAGGACCGTCGCATCGTAGAAGTTTTTGCCGATGCCACTCATTTTCCCTCCAGTTAGGAGCTTGGCCCCGT
GGTTCACAGCGTCATCCACTAGCGCGGTCACTTTTTCGACGGGCTCAGGTCCGAATCAACGCCCCCAGCTTCACGCCGTGCTCCAGTGGAAGACAATCTT
GAGATCTTCGACTCGCTCGACCAACTTGGAGGTGAATTTGTCGTAGATGGACAAGTGGACGAAGATGCGGTTGCAGGTGACACAGGTCTGTCCGCTGTTG
CGAAATTTGGCCGCAATCAATCCGTCCAGCGCTTTCTCGATATCGGCATCTTCAAAAACAATAAACGGCGCGTTGCCACCCAGCTCAAGAACTACGCGCT
TGACTGTTGAGGACGCTTGCTCCAACAGCTTTTTGCCCGCAGGAGTAGATCCAGTAAACGCCACGAGACGAACATCGGGGTTCGTCGTCAGCTCTTTCCC
AATGCCCGAGTGGCTACCGCGTGGAGAAGTCACCACGTTGATCACTCCAGCTGGCACTCCTGCATCTTCCGCTAGCTTGGCAAGAGCGAGCATCGACAAC
GGCGTTTTCCCAGAAGGCTTTACTACGGCTGCACAGCCCGACGCAACACAAGGCGCTAGGCTCCGGGTCACTGTCGCGTAAGGGAAATTCCATGGCGACA
TGATCGCGCACACCCCCACAGGTTCCTTCATCACCAGCACCTTCTTGTCAGCGTCCGACGGAGTAACCAAATATCCGCTGGAACGGACGATCTCGTGAGC
ATAGTACTCAATAATACCAGCAGTGAACTCCACCTCGATCTTAGCCTCCTCAAGCGGCTTGGCGCTTTCACAAGACGCGATAATCGCCAGGTCTTCAGCA
TTTTCGGCAATTGCAGCATGCCATTTCTTCATCACGGCTGAGCGGACCTAGTTAGACAAGGTGACAGCACAAAAACGTCAAAAAGCGTGTCAAGGCTTAT
TTGCTTCTCAAACCGACCGGCGGAGTAGCTTTCTTCCAGCGACGTTGGGCCACGAACGCTGCTGCAATAGCCTCGTGAGCTTCCTCCTTCCCCATACAGG
CCACTTGAGCGAGTTCTTCATCCGTGGCAGGATCTAAATCGCTCAAGAATGAGTCAAGTCTGACGAATTGGTCTCCATACAGTTATCTACTTACCAACGA
CGGCGAAGTAGTCTCCTCCATGCCCTTCGACCCATTCGCCATTCACGAAGCCCGTTGAGCGTACGAGCTC