Description :
From Genome Similarity Track
Location :
contig_45:118593- 119602
Transcript NameFunction/comments
g9903.t1XP_009515770.1 hypothetical protein PHYSODRAFT_358530 [Phytophthora sojae

Sequence
1009 bases(100 bases per row)
TCGTGGTAGCTTCTCCTACAACGACTCTGGTCGCGACCGAGATCGCGATCGTAGCCGCGATCGTGACCGCTATAACCGCAGTGACAGAGGAGGTGACTAT
GACCGCCGCGACCGGGGATACGGTGCTTCTTCGGATAGAGAAAGATATCGCCGAGACGACAGAGATCGTGGAGACAGGAGTCCAAAGCGGCCGCGCGTAC
AGCAGTGCCGTAAATGCCGTCGTGCGAAGTCTGCGTGCCAGTGCAGCTTTCGTGGTCGTTAGCTGAGCTGCTAACTCGAACTAACCGTCAAGATTCGAGG
TAGAAGAATAGTCGGCAGAGCGCAGGGGCTTGATGGTTCAAGTCGGTAGAGACCTAAGCTTGCAGCTAGTTACGATACACTTCTGCCATGAACGAGCTAT
GAATACACGCTGTACGCTTGTTCAAACCACTGGCACAGCCCAATAGTTGCTTCGAGCTTGAATGTTGCAGCTTCGTGTGGCTTGTGACCAGACCAGCGGC
TTTTGTCGAGGCCAGCACCACGCGAACGTAGGGCGGTAAATGTTCAACACGTCCACGAAAGTTCGCTGGTATTCATGTTCTGTACTACATCCACAGCTTC
TGCCCCCCGCACCAACTCTCAAAGTACGCTCAATTTGTGATTCTCAGATGTGCATGTATCCATTGCAATAGTCTGCTCTAGGCGACCCAAGCGATCGCCA
ACTCTGGAAATGAACCCGGGCAAGAAACTACGATACAAGCGAAGTCATCTCCATCAGCAGACGCAAGTAAAAGAGACCCGAACGAGATTCTCAGATCCGC
GTCGAACCTCGAGCTGAACGAAAGTATCAGTACGAAGAAATAGATTGATGTATTACCTTGTTGCGCTATACGAATACGAATGCTTGCAAGTCCCCAACCA
AGACATGACATTGTCGTCTCGAGCAGGTGAATTTTGGGCTATTATTTTTGTCTTGGAACTGCCGCCATGCCGTTCACTCTTGTTCGCCAGCTCAATCTCC
GAGACCCTA