Description :
From Genome Similarity Track
Location :
contig_45:118592- 119611
Transcript NameFunction/comments
g9445.t1XP_009515770.1 hypothetical protein PHYSODRAFT_358530 [Phytophthora sojae

Sequence
1019 bases(100 bases per row)
GGTAGCTTCTCCTACAACGACTCTGGTCGCGACCGAGATCGCGATCGTAGCCGCGATCGTGACCGCTATAACCGCAGTGACAGAGGAGGTGACTATGACC
GCCGCGACCGGGGATACGGTGCTTCTTCGGATAGAGAAAGATATCGCCGAGACGACAGAGATCGTGGAGACAGGAGTCCAAAGCGGCCGCGCGTACAGCA
GTGCCGTAAATGCCGTCGTGCGAAGTCTGCGTGCCAGTGCAGCTTTCGTGGTCGTTAGCTGAGCTGCTAACTCGAACTAACCGTCAAGATTCGAGGTAGA
AGAATAGTCGGCAGAGCGCAGGGGCTTGATGGTTCAAGTCGGTAGAGACCTAAGCTTGCAGCTAGTTACGATACACTTCTGCCATGAACGAGCTATGAAT
ACACGCTGTACGCTTGTTCAAACCACTGGCACAGCCCAATAGTTGCTTCGAGCTAGAATGTTGCAGCTTCGTGTGGCTTGTGACCAGACCAGCGGCTTTT
GTCGAGGCCAGCACCACGCGAACGTAGGGCGGTAAATGTTCAACACGTCCACGAAAGTTCGCTGGTATTCATGTTCTGTACTACACCCACAGCTTCTGCC
CCCCGCACCAACTCTCAAAGTACGCTCAATTGGTGATTCTCAGATGTGCATGTATCCATTGCAATAGTCTGCTCTAGGCGACCCAAGCGATCGCCAACTC
TGGAAATGAACCCGGGCAAGAAACTACGATACAAGCGAAGTCATCTCCATCAGCAGACGCAAGTAAAAGAGACCCGAACGAGATTCTCAGATCCGCGTCG
AACCTCGAGCTGAACGAAAGTATCAGTACGAAGAAATAGATTGATGTATTACCTTGTTGCGCTATACGAATACGAATGCTTGCAAGTCCCCAACCAAGAC
ATGACATTGTCGTCTCGAGCAGGTGAATTTTGGGCTATTATTTTTGTCTTGGAACTGCCGCCATGCCGTTCACTCTTGTTCGCCAGCTCAATCTCCGAGA
CCCTATCGGCGTGACAAGT