Description :
From Genome Similarity Track
Location :
Scaffold_421:11858- 14688
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_421-snap-gene-0.7Unc-115, isoform B
Pytiw_DAOMBR242034maker-piw_contig_421-fgenesh-gene-0.2Conserved gene of unknown function

Sequence
2830 bases(100 bases per row)
GACCAGTTTGATCTCGGCCCGTTCGCGACTGATGGACATGAGCGCATGTCGGAGATGTCGGACTTTGGCTCGGAGTTCGGTGGCGACTACTCGTTCATGA
ACAACAACCGCGACTCGATGCGCCTCTCGCAGGTGCTCGACCTCGAGTCGATTGACGCGTTCAACAACAGCGCGCGCAGCAGCCGCGGCTTCGAGCGCCT
CTCGACACTATCGGACATGTCTGATCGCGTGTCGGAGGCCCGTCCGTCGGACCGCCACGCGCACCCATCGTTGCGAGAAGAAGATGGCGAATACCTGTCG
GACGAAGACGGTGAGCAGGAGCTTTGTGGCGGTTGCAACCTTGTGCTCGAAGGCGAAGCTGTCGGTGCCTTGAACCGATACTTCCACTACGAGGTACGGA
TTGGTTATTGATGAATCTGCCTGACAACGGGACAAGTCTATTGACCGTGTTGATTTTTTTTGCGAACAGTGTTTCAAGTGCAGCCACTGCCGCAATGTGA
TCGCGGAAGACGACGGCTACGCAGAGAAGGACAACAAGGTAAATGCATGTTTCTACGGTGCATGATGACGATGCGCGTGTACCAATGTGTTTTATATCTT
TCCCTGTCCAGGCGTACCACCAAGAGTGCTACCAGGAGAAGTTTGGCAAGCGCTGCTGCCGCTGCACGCAGGTTCGTTCGGTTTGCTGTTGCTCCATGCC
TTCCTATTCGCAAACTGACACTGATGAAATTACATTCTTTATCTTGCAGACTTTGAAGGGCAAAGTGGTCAAGGCTCTCGACAACCTCTACCACCCAGGC
TGTTTCGTCTGCTTCAAGTGCAGCTCGTCGCTCTCCGGTGCGTTTCTCACCTGCTTGTTCGATGGGGTCTTACGGATATGTGATGTAACTTTGCTGTTCT
CTAATTGCTGTATTACAGAGAGTTTCTTTGAACACGAAGGGCAAGCGGTGTGTGCCAAGTGCAAGCACAGCGCCATTACGCTCGAGGAGCCGGTCGTTCA
GTAAGTACATTTCGCTTCTTGAATCACACAAGTGGTTGACTGTTACTGAGATCTGACCAAATGTGCCACTTGCTTGAATGAACAGAGAGAACAACACTCC
TACTAGCTATGCCACTGTCGGCTACCAGTTCTCGGCTCAGGTAACACATTCACAACATATCAAGCTCAATCGCGTCAACAGCCTAACAAATTCTACTTCC
TCAACCTTGCTTCAACAGGACGAGACGCAGCTCACCATGTACCCGGGTGAAGACGTGGCGATCCTCCAGAAGGACGACGACGGCTGGTGGCTCGTGGAGA
TCAAGAAGAAGCGCGGCTACGTACCAGGCTCGTACTTGGTGGAGCTCCCGCCCAAGCAGGAGGTGAAGGCGCCAGTCCCTGGACTCTGCAGTGAGTGCAG
CACGCAGAATCCGGATGTCGCGCGCTTCTGCCGCAGCTGTGGAAACCAGCTCATCGAATAAGTTTGACGTCGGCACAGAAGGTGGACGGAACGTGAAAGC
CCAGCGAGTGTCTTTAAAAACGGTGGGTAGGCCTCGCTCTTGTCTATGCAACGCTGGTTTGTTTTGCTTCGTAGAACGAGAGAAGGGGAAATAAGAGAAA
GGATCGCCGTCGGTGGAAAGGTATGAGCGGTATGATTGGTGCTAACCAGAGAGGCGGAATAATGTCATGTAGCTGTTGTGTGCGCTGCTCTTCCCTGTCT
CATGCGTGCGGCCTTCATGCGGTACATTTTGCAATTTCAACGTCCTAACTTGTTCTAACCGTTGTGTGCGTTGCGAAGGTGTTTGTGGCAGTTGGGCCAG
AATGGACCAGTCTCCCATGTCTCTCTGAGTGCCATAGATTTGCTCGTTGACTCTCATCATAACGCTTTTTGCCTGAAGAAGTGAAGCAGAAGTCCAAGCA
AGATGTTCCCTCAGAGCAAGTCGCTAATTGCGCTTGTGCCGATCGGGTCTCGTTTCGCTCTCGCTTCGGCTCGTGATGGTGTGAAGAATCTCCAGCACCA
GCAGCTTCAGCGCGCAGGGATCTCGACGTGGGACCGCGTGCGTTCGTCCATGTGGCACCCGATGGCTACGATGGAACAGTCGCTGCTGGACGTTGAGCGC
ATGACGTCGCAGTTGTTCTCCGGTGGTATGTTCCCGTCCGCCCAGAGTTTGTTGCCACGCATGCGCATCGACGACGACGACTTTTTCCAAGATCTCGAGG
TGACCTCTCCGAAAGAAACCCCGAAGCCTGACAAAGACCAGCAGAAGCAGCCGCAGAAGCAAGGTGAGCACCAGGGGAACTCGTACTCGTCGTACTCGTT
CAGCAGCTCCACCGTGCTGGACAAGCAGGGCCACCGCGTCTCGACGATCCGCCGCCGCTACGAGGACTCGTCTGGCCGACTGAAAGCGTTCCACGAGCGC
GAGATCGACGGCATGAAGCTGAAGAAAGTGTGGAAGCGGAAGTCACCGGATGACAAGGGCGAGCACCGCACGATCACCCACGGCGCCAGTGTGGAAGAGT
TCGAAGAGCAGTGGAAGAACACGCCGTTCGGCCAGGCTGAGAAGGAGCAGCAGAAGCTTGGCGGCGACAAGAAGCAAGTGAGCGAGGGAGGTGAACACAA
GGGCGAAGAGACCACGGCTACAAGCGAGCACATGAAGAACGTGGAAGAGATGAAGAAGATGCAGGAACAACCTACATCGGCGTTCGGCATGGACTACGGA
GCTGCTGAGGCGGCGCCAGACAAGGAGTACGGCAGGGAGGCCGAGGGCGTGACGAAAGAGGCTAAGACCAAGTCCCGTGACGAAGCCATCGCCCAGGGCT
CCAAGAAGCAGGAGGAGGAGACGACACCGC