Description :
From Genome Similarity Track
Location :
contig_82:118559- 121580
Transcript NameFunction/comments
g12093.t1hypothetical protein
g12094.t1hypothetical protein
g12095.t1hypothetical protein

Sequence
3021 bases(100 bases per row)
ACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACGCGCTGAAGGCCTTCTACGAAGTCG
AAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGCT
GCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGACT
CCATTCGAGATCGTGTACAAGTCCAAGCCAAGTGTCAAGCACATGCGTGTGTTCGGATGCCAGACGTACATCCTGACGCCGAAGGAAAAGCGGCGCAAGT
GGGACCCCAAGGCTCGCGCCGGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGAGGCGGGGCAGGTGGTTGTCAGTCG
CGATGTCAACTTCGATGAGTCGGCCTTTGGACTTTCGGCGCATACTTCGGATGAAGACGTCGATGATGCTGCGCTGGACCTGGACGCGCTGGACCTGGAC
GACAACGATGGACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCGCAAGAACCGACCGAGTGGCGACGACGACACTGCCAGAAGATCGCGCCCCGTTC
GCCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTCCTCCTCGCGCCGAGCTGAACCCGACGAAGAAGAAAAGTCTGGGGACCAAGATGAAGACG
ACGACCCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCTATCGGAGCCGACGACGTTCCAAGAGGCTGTGAACGG
TCCGGATCAGGTGCACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATGCGACTGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCCAGCGGCCAGCGC
GCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGCAGAAGT
ACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGACGCTGCGCATGATCATCGCGATCGCCAAGTACTTCGGCTGGCCCCTCGACCA
ACTCGACGTCGTGACAGCGTTCCTGTACGGGTCATGAAGGGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGGTGGGTTCGACTGCCTGGA
ACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACGTTCGACGAGTTCATGTGCTCTATCGGCTTCCAAGTGTCGGCCTTC
GATCCGTGCCTCTACATCAAGGTGGTGGACGGTCACTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCGCCCGAGCTGATCT
CGCGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGTAGACGGCCCGGACGGCAG
CGTGACCATGTGCCAGCGTCGCTACGGGACGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTCCGGTGGACATGAGCACTCGAC
TGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGATGACCGCCACGCGCCCGGACATCGCGTA
CGCCGTTGGCTATGTGTCGCGTTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCCCAAGACGCATG
CATCTGCTCAACCGGGCGACCAATCGACTTTCGTGGCTACTCGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGCTACACGTTCAT
GCTGATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGTGTGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCAGCCTGGCTATCCAA
GAAGGCAAGTGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCACGAGACGGGACCCGAGCTCATGATCCGCGAAGACAACCAGTCGTGCATCAA
GATGACCAAGAAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACACAAGTACCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGCTCGAG
TATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACCAAGGCACTTGCGGACCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCATGGGACTTC
GCATTGAGGGGGCGTATTGAGGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGC
CGATTACGCCACCGACGATTACGCCACTGTCGATTACGCTACCTGTGGGTACAAGATTGTAGACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGCTG
AAGTAACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAATCACTTTCG
AATCTTCGTTCTACCCCTCAAGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCACGGTGTCCAAGATC
CATACCTTCCATCACTCCGCTCCGTCAAGCTTCACGGTGTCAAGATCCATACCTTCCATCAGGTTATGAGCCCAAGCACCATGTCCTCTGCCCACGACGC
CTCCACCAAGGTCTCCATCGACAAGTTCAACGGAGACAACTACGCGACGTGGAACCGCTACATGCGTGGCGTGTTCCTGACCAAGTCGGTGTGGCATGTC
GTGAACCGAGAGACGACGCCG