Description :
From Genome Similarity Track
Location :
Scaffold_482:11854- 13621
Transcript NameFunction/comments
Phyag_g6074conserved hypothetical protein

Sequence
1767 bases(100 bases per row)
ATGCAGCTCCGGTTCCCGTTACCGGCGGGGTACTTTGCCAAGTTTGACTTGCTGCCGAACGAGGTGCAGAGCTACCGGTCGTTAGCGAGCGACATCGTCC
GTGAGACGATGCACGACTTGGACCACTACGTCAAGGACGGCCGAAAGCTCATCGACGGACACACATGGAAACTCGCCAAGTCCAAGGAGCGACTGCACTG
CTATCGAAAGCGCAGCACGCAAGGCTCGGCGCACCAACTCGGACTCTATGGCAATGCAGGCGCCGATAGCGATTCGGTGGGGTATTCGACGCGCTCGCGT
CCGTCCATGAGCATCACGAGCTCTCACAGTCGTTCGGACCACGAGGACATGGGTAACTTGTCGGTGTCCACTCGGTCGTCGGATGACGGCGAGCCGAGTC
GCAAGAGCATTCAGCCGGCGGTGATCGGCTACGGTATCGTGGACGGTTCTGTGGACGACCTCGTCTACGGCCTGTACCAGTCCTCGaccgacgagatgaa
gacgttgtCTGCGTTCCTTGGTGACGACTCGCTCATCGACTGCGCGGTGCTCAAGACGATCCGGCAGACGCGTTCGTCGTACCTCGGACTCAAGTGGAAA
TTATCTCGCACGGTAGGCGGCAACCGGGACTGCTGCTACATGGAGTACGTCGGTGTGTCGGAGGACGCCAACGGCCAGCGCTTCGGCTACCATGTGCTGG
AGTCGGTGGCTGTCCGCAACTGTCCGCATTTCGATGACAACTCGATCGTCCGTACCAACTTGTCGTTCTGCTTTATCTTCCGACCGGGCAAGCTGgctga
ccaagttgaagtgttcaTGGAGGGCGCGTATGATTCCTCGGCTGACGTTCTCACCGCTGGTGGCGTGGGAGACTACCGCACGACAATGGATATGTTGTTC
AACCTCCCGACGGCATTAGTGGGGGCTGAAGCGAAGAAGATTTCGGCTATGGTGGCGAAGCAATCCGGGGCTCTCCGTGGTGCGAGTAGCAAGAACCAGA
GCGGTAACCACTGCTCTATCTGTCGTGCCAAGTCGGGCTTGCTGTCTTCGCACACGAACTGCCAGACGTGCGGCGCCGTTATTTGCAGCAAGTGCCGCAT
CCGGAAGGTGACGTTCTCACGCCGAGGCAAGATCAAGGTCTCGTGCTGCAAAATGTGCATGGTCATGGTCAAGGACCAGTCGCCTTTCGCgggcgagcag
ctcgagcagcagccagcaaaACCCAAGAAGGCATCACGGGACGACAGTCGCAgcaggaacgacagcaacagcagcaataacacAAGGCTGGACATGATCA
ACGCGTCCGTCTCGACGATGTCACTCACCGACTCGGAATTTTCGTCCTCGTACCAGTCGTGGCAGTCCAGTTCAGTGTCGTCGTTGCAATCGGACGTCGA
CGATAGCTTCCACCACTCCAATGGACCGAGCAGTGCAATGGTGCCGCTTGACCGGAAGATGCCAGCATTGATGGAGAGCGAACTGCCCCCGCATCCCCCT
TCGTCGTACCAGAGcgagcaacaacaccaatacgagcagcaacaattccagcagcagcagttcttgATGCGACAACGCATGAAGCAAAGCACATACCCGA
ATATGCCGCCGATGCCCAGCCAACGCCAGCCAGCTACTCGCGAAGGACTATACAACcaaatgctggagctgcagatgcaagCGGAGCGGGCCTACAACTT
GACCAACCAAAATGCCAACATGATGAACCCGAGACGATAGTTAGTGAACTGATCGAAGCGAGTGCTC