Description :
From Genome Similarity Track
Location :
contig_12:118525- 121467
Transcript NameFunction/comments
g3916.t1OWY90789.1 Pectate lyase [Phytophthora megakarya
g3917.t1hypothetical protein

Sequence
2942 bases(100 bases per row)
CGTATGGCTCGACTAACTACCACCGAAGATCGACCGGGATATATTGTTAATACATGTGACTAATGACATCGAGGTGGTCGAAGTTGTGATTCAACATGCA
TCAATGACAGCAACGACGGTTTGCATAAGATTTTTGCATACACACAGTGAGTTGCAGGACAACGTTGAGGCGCCCGCACTAGTTCTCGCTCGCAATTTTT
GAGAGCGAGCTGCGGTCGACGACAGGCAACACGATCACGCCATGGACCTAGCAACGGTATCCGGTCGCTTTTACATGGCTGTACAAAAGTAAACGAGATG
CGTGCGTGGGTGTTGGTTTCCAGTAAACCACCTGCCTGTCAGGTTCCGTGTTGGCACTCAAGTTGTAGACATCTACAACCGTTGGAGATGACATGAAGAT
GCCACGGAGACTGCTAATGTAGTGTGCAAACCTGGTGAAGATCGGAGCCCGTTCGACTAGTAGAACCGGATTCAGTAGTCGATTGGATTTGCCATACAGA
AAAACTACACTCCCAACATCCTTGTGACGGTGGATCGCGCACAGATGCTTTTCGGGCAAGCTCGGGAATCTACAGCAAGATGTCGTGAGCGAAAGTGGTC
AATCCGATCCGCCGATCGACGAAGCTCCTGTCAGAAGTAAGTTTGCGCTTTGTAGGCTTGACATCTCGCCGAACTGAGCGCTACAAACTCGACACTACAA
CATTGCCTTTGGTGCCGTCGTTGGAACCAATTCCACTGTGGGCGTACATAAATATCAATCGCTTTGCTGTTCGAGCATTTCCGTACACGTACCGGTCTCC
CACGTGATTGTCGATCCCTGTCCCCCTCTTGGCTTAGAACTGCAAGCCCCTGCGCTTGTTTCTCTACCTGCTTCCTCTCTCATTCTGCAACTTGCTTTCT
ACAACTCACACACCTCCACCAACACAAGACCAAGCCTACTACCCCGTCATGGCTCGTACCATCTCACTCCTCTGCGCCGTGCTCGCCGCCGCCGCTTCGG
TCTCCTCGGCCTGGCCCACCAGCAAGGGCAGCGTCCGCTTCAACGGCGTCAAGATCATCAAGAAGGGGGAGACCTTCGACGGCGGCATGAAGACGTACCA
GCGCTCCGACCTCAAGTGCCAGGGCCAGTCGGAGGGAGGCTGGCGCGACGCCGTCTTCAAGCTGGAGCCCGGAGCCAAGCTCAAGAACGTCATCATCGGC
CCCGACCAGCGCGAGGGCGTCCACTGCGAAGACAGCGACTGCACCGTCGAGAACGTGTGGTGGGAGGCTGTGTGCGAGGACGCGCTGAGCATCAAGGGCG
GTAACAAGAACAGCGTCACCAACGTGCTGGCGTGTGGCGCCAAGAACGCCGACGACAAGGTCATCCAGCACAACGGCTACGGCCACGTCAACATCAACGG
CTTCTACGCCGAGAACTTCGGCAAGCTCTACCGCTCGTGCGGCACGTGCGGCAACATCAAGCGCACTGTGGCGCTGAACCACGTGTGGGGCAACAACCCC
AAGGTGAGTCTCGTGACCGTGAACGCCAACAACGGCGACGTGGCCACCTTCACCGACGACATCCACGTGCACTCGAGCAAGGGCGCCAACGCGGTGTGCC
AGACCACGACGTCCACGAACGGCAACGAGCCCAAGGTCACGAGCAAGGGGCCGTCCAAGAACTGCGTCTTCAACAAGGACAAGATCGAGTTCTACTGAGC
AGCGTTTGTTGGACTGCGCATTGTCTGGTTAGCGTAGTGTGTCTGCGTGCGAGAGTAGATGGCCGGCTGAAAGTTGAGAGCAATTGCCTACTTCCCTAAA
CTAAAATAAGCCTCGCATTATGATCTTTGTGCTATCGTCGCCACTTGCAGCACCAGGACATGTACTTGCTTTCGCCGGACATGCGTGGGTTTCATACCTT
AAACGATGATGTTTACCGCTTTGACAATGCGCTTCGTGATTGTCAACCAACGACAGAGCTTGTTGCAGCGTCTAATCTTGTGTTCCTGCGTTGTGCATCG
CTTGCTGACATCGGTACTCTATGCAAGTTACTTCGCCAGGTGGCTGCCATTCGTCGACAACTTGTTGATACAAAGATGTTAGATGATGACTAAAGAGAAA
GAGACTCGCGACCAGCTGGCGAAGTAACCTGCGCGAATGACGTCGATAAATCAAGCGATGTAAAGTCTCGAGTGCTAGCGCAAGTCCATTCTACGTAGTA
CAAAACGAAGAGCGTGCATTCCACGGTACTGGTGCTAATAAATATGTACGAAGGCCCTTACAGCAACTTGGTGTTGCGCTCAGCGAGTCGTTGCCTCACC
AGCTCGAAGACGCCATTGCGGCCGAAAATGCAGCAAATCTGGGAGCTCTTCTTGTGCAGCGCCTGTCTCTCCTGCTGCAGCGCGGTGAACCGAGTCGTCA
GTTGCTGGAGCTGCTGCTCGTGGCACGTGCGAGCGCCACTCAGCACCTTGAGCATGTTCTCCTCTTCGTCGCGCTCCTCGCCCATATTCATCAGGGCCGA
CGCCGTATCCACCACAGCGGGCACGTTGCCAGCCTCGAGCTCGCACACGAACTCGTCGATGGCCTCGATGCGGTCGCAGCAGTCGGCGATGTCGTCGGTG
TAGGTTTCCACCTCCTCGTGGTCGTCCTTAAGCGCCAGTGCCAAGTCATCCAGCTCGACGTCGATCTCGTGCACGCGCGCCACCGCGGCCTTGAGCTCCA
GTACCAGCGCTAAGTTGGTCACCGTTGCCAGTGGACGACTCATGTTCTGGTCCATTTGCTTCGCGTAGGGAAGAAGAATGCCTTGTCTTGCTCGAGGAAA
ATCGGAGACTGAGACCAGCGGCACGTCTCGCGACGACGGACCTGTCAGCTGTGCCGCTGGTCTCCCCCTGCTGACAGCAACGCGCTGAACCTACGATTGA
CATGTCGTCAACCAACAGCTCCACATAGATATGCCGTTGGAC