Description :
From Genome Similarity Track
Location :
contig_12:118513- 121455
Transcript NameFunction/comments
g3738.t1OWY90789.1 Pectate lyase [Phytophthora megakarya
g3739.t1hypothetical protein

Sequence
2942 bases(100 bases per row)
TCACAGAGCCCTTCTGGTCGTATGGCTCGACTAACTACCACCGAAGATCGACCGGGATATATTGTTAATACATGTGACTAATGACATCGAGGTGGTCGAA
GTTGTGATTCAACATGCATCAATGACAACAACGACGGTTTGCATAAGATTTTTGCATACACACAGTGAGTTGCAGGACAACGTTGAGGCGCCCGCACTAG
TTCTCGCTCGCAATTTTTGAGAGCGAGCTGCGGTCGACGACAGGCAACACGATCGCGCCATGGACCTAGCAACGGTATCCGGTCGCTTTTACATGGCTGT
ACAAAAGTAAACGAGATGCGTGCGTGGGTGTTGGTTTCCAGTAAACCACCTGCCTGTCAGGTTCCGTGTTGGCACTCAAGTTGTAGACATCTGGAACCGT
TGGAGATGGCATGAAGATGCCACGGAGACTGCTAATGTAGTGTGCAAACCTGGTGAAGATCGGAGCCCGTTCGACTAGTAGAACCGGATTCAGTAGTCGA
TTGGATTTGCCATACAGAAAAACTACACTCCCAACATCCTTGTGACGGTGGATCGCGCACAGATGCTTTTCGGGCAAGCTCGGGAATCTACAGCAAGATG
TCGTGAGCGAAAGTGGTCAATCCGATCCGCCGATCGACGAAGCTCCTGTCAGAAGTAAGTTTGCGCTTTGTAGGCTTGACATCTCGCCGAACTGAGCGCT
ACAAACTCGACACTACAACATTGCCTTTGGTGCCGTCGTTGGAACCAATTCCACTGTGGGCGTACATAAATATCAATCGCTTTGCTGTTCGAGCATTTCC
GTACACGTACCGGTCTCCCACGTGATTGTCGATCCCTGTCCCCCTCTTGGCTTAGAACTGCAAGCCCCTGCGCTTGTTTCTCTACCTGCTTCCTCTCTCA
TTCTGCAACTTGCTTTCTACAACTCACACACCTCCACCAACACAAGACCAAGCCTACTACCCCATCATGGCTCGTACCATCTCACTCCTCTGCGCCGTGC
TCGCCGCCGCCGCTTCGGTCTCCTCGGCCTGGCCCACCAGCAAGGGCAGCGTCCGCTTCAACGGCGTCAAGATCATCAAGAAGGGGGAGACCTTCGACGG
CGGTATGAAGACGTACCAGCGCTCCGACCTCAAGTGCCAGGGCCAGTCGGAGGGAGGCTGGCGCGACGCCGTCTTCAAGCTGGAGCCCGGAGCCAAGCTC
AAGAACGTCATCATCGGCCCCGACCAGCGCGAGGGCGTCCACTGCGAAGACAGCGACTGCACCGTCGAGAACGTGTGGTGGGAGGCTGTGTGCGAGGACG
CGCTGAGCATCAAGGGCGGTAACAAGAACAGCGTCACCAACGTGCTGGCGTGTGGCGCCAAGAACGCCGACGACAAGGTCATCCAGCACAACGGCTACGG
CCACGTCAACATCAACGGCTTCTACGCCGAGAACTTCGGCAAGCTCTACCGCTCGTGCGGCACGTGCGGCAACATCAAGCGCACTGTGGCGCTGAACCAC
GTGTGGGGCAACAACCCCAAGGTGAGTCTCGTGACCGTGAACGCCAACAACGGCGACGTGGCCACCTTCACCGACGACATCCACGTGCACTCGAGCAAGG
GCGCCAACGCGGTGTGCCAGACCACGACGTCCACGAACGGCAACGAGCCCAAGGTCACGAGCAAGGGGCCGTCCAAGAACTGCGTCTTCAACAAGGACAA
GATCGAGTTCTACTGAGCAGCGTTTGTTGGACTGCGCATTGTCTGGTTAGCGTAGTGTGTCTGCGTGCGAGAGTAGATGGCCGGCTGAAAGTTGAGTGCA
ATTGCCTACTTCCCTAAACTAAAATAAGCCTCGCATTATGATCTTTCTGCTATCGTCGCCACTTGCAGCACCAGTACATGTACTTGCTTTCGCCGGACAT
GCGTGGGTTTCATACCTTAAACGATGATGTTTACCGCTTTGACAATGCGCTTCGTGATTGTCAACCAACGACAGAGCTTGATGCAGCGTCTAGTCTTGTG
TTCCTGCGCTGTGCATCGCTTGCTGACATCGGTACTCTATGCAAGTTACTTCGCCAGGTGGCTGCCATTCGTCGACAACTTGTTGATACGAAGATGTTAC
ATGATGACTAAAGAGAAAGAGACTCGCGACCAGCTGGCGAAGTAACCTGCGCGAATGACGTCGATAAATCAAGCGATGTAAAGTCTCGAGTGCTAGCGCA
AGTCCATTCTACGTAGTACAAAACGAAGAGCGTGCATTCCACGGTACTGGTGCTAATAAATATGTACGAAGGCCCTTACAGCAACTTGGTGTTGCGCTCA
GCGAGTCGTTGTCTCACCAGCTCGAAGACGCCATTGCGGCCGAAAATGCAGCAAATCTGGGAGCTCTTCTTGTGCAGCGCTTGTCTCTCCTGCTGCAGCG
CGGTGAACCGAGTCGTCAGTTGCTGGAGCTGCTGCTCGTGGCACGTGCGAGCGCCTCTCAGCACCTTGAGCATGTTCTCCTCTTCGTCGCGCTCCTCGCC
CATATTCATCAGGGCCGACGCCGTATCCACCACAGCGGGCACGTTGCCAACCTCGAGCTCGCACACGAACTCGTCGATGGCCTCGATGCGGTCGCAGCAG
TCGGCGATGTCGTCGGTGTAGGTTTCCACCTCCTCGTGGTCGTCCTTAAGCGCCAGTGCCAAGTCATCCAGCTCGACGTCGATCTCGTGCACGCGCGCCA
CCGCGGCCTTGAGCTCCAGTACCAGCGCTAAGTTGGTCACCGTTGCCAGTGGACGACTCATGTTCTGGTCCATTTGCTTCGCGTAGGGAAGAAGAATGCC
TTGTCTTGCTCGAGGAAAATCGGAGACTGAGACCAGCGGCACGTCTCGCGACGACGGACCTGTCAGCTGTGCCGCTGGTCTCCCCCTGCTGACAGCAACG
CGCTGAACCTACGATTGACATGTCGTCAACCAACAGCTCCAC