Description :
From Genome Similarity Track
Location :
contig_82:118510- 121531
Transcript NameFunction/comments
g10258.t1hypothetical protein
g10259.t1hypothetical protein PHYSODRAFT_329070

Sequence
3021 bases(100 bases per row)
ACGTACGTCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACGCGCTGAAGGCCTTCT
ACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCG
CAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGTGGAG
CACAAGACTCCATTCGAGATCGTGTACAAGTCCAAGCCAAGTGTCAAGCACATGCGTGTGTTCGGATGCCAGACGTACATCCTGACGCCGAAGGAAAAGC
GGCGCAAGTGGGACCCCAAGGCTCGCGCCGGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGAGGCGGGGCAGGTGGT
TGTCAGTCGCGATGTCAACTTCGATGAGTCGGCCTTTGGACTTTCGGCGCATACTTCGGATGAAGACGTCGATGATGCTGCGCTGGACCTGGACGCGCTG
GACCTGGACGACAACGATGGACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCGCAAGAACCGACCGAGTGGCGACGACGACACTGCCAGAAGATCGC
GCCCCGTTCGCCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTCCTCCTCGCGCCGAGCTGAACCCGACGAAGAAGAAAAGTCTGGGGACCAAG
ATGAAGACGACGACCCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCTATCGGAGCCGACGACGTTCCAAGAGGC
TGTGAACGGTCCGGATCAGGTGCACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATGCGACTGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCCAGC
GGCCAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCA
AGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGACGCTGCGCATGATCATCGCGATCGCCAAGTACTTCGGCTGGCC
CCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGTCATGAAGGGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGGTGGGTTCGA
CTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACGTTCGACGAGTTCATGTGCTCTATCGGCTTCCAAGTG
TCGGCCTTCGATCCGTGCCTCTACATCAAGGTGGTGGACGGTCACTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCGCCCG
AGCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGTAGACGGCCC
GGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGGGACGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTCCGGTGGACATGA
GCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGATGACCGCCACGCGCCCGGA
CATCGCGTACGCCGTTGGCTATGTGTCGCGTTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCCCA
AGACGCATGCATCTGCTCAACCGGGCGACCAATCGACTTTCGTGGCTACTCGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGCTA
CACGTTCATGCTGATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGTGTGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCAGCCTG
GCTATCCAAGAAGGCAAGTGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCACGAGACGGGACCCGAGCTCATGATCCGCGAAGACAACCAGTC
GTGCATCAAGATGACCAAGAAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACACAAGTACCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTG
AAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACCAAGGCACTTGCGGACCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCA
TGGGACTTCGCATTGAGGGGGCGTATTGAGGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTCCAATCCG
AACCCACGCCGATTACGCCACCGACGATTACGCCACTGTCGATTACGCTACCTGTGGGTACAAGATTGTAGACAAGATGGGCTTCGACGTGGCGCTCTCT
CATTGGCTGAAGTAACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAA
TCACTTTCGAATCTTCGTTCTACCCCTCAAGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCACGGTG
TCCAAGATCCATACCTTCCATCACTCCGCTCCGTCAAGCTTCACGGTGTCAAGATCCATACCTTCCATCAGGTTATGAGCCCAAGCACCATGTCCTCTGC
CCACGACGCCTCCACCAAGGTCTCCATCGACAAGTTCAACGGAGACAACTACGCGACGTGGAACCGCTACATGCGTGGCGTGTTCCTGACCAAGTCGGTG
TGGCATGTCGTGAACCGAGAG