Description :
From Genome Similarity Track
Location :
Scaffold_206:11850- 16521
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_206-snap-gene-0.11ATP-binding Cassette (ABC) Superfamily
Pytar_ATCC12531maker-par_contig_206-fgenesh-gene-0.0Calmodulin binding protein
Pytar_ATCC12531maker-par_contig_206-fgenesh-gene-0.5Protein kinase

Sequence
4671 bases(100 bases per row)
CTCATCGAGAAAGACCAGTTTACTGTCGCCGATGAACGCGAGCGCGACGCTGAGCTTGCGCTTCTGTCCGCCCGACAGGTTCTTGGATGCGACCGTGCGC
TTCTCGGTGAGCCCGACTTCCTGGATCATTTTCTCAACCTCGTCTTCCAAGAGGTGCGGCGGCACGTGCTTCATGATGCCGAAAAACCGCAAGTGGTCCT
GCACCGACAGCTCACCGAGCAGCACATCGTGCTGGGGGCAAATGCCCATGATCTGGCGGAGCTCGTCAAAGTCCGTTCGAATGGATCGGCCAAAGAGCAC
GGCATCGCCACTTGTAGGCGGAGTTAGTCCCGTGAGCATAGCGATCGTCGTGGTCTTGCCGGCGCCGTTGTGGCCCAGCAGCGCCGTGATCTGACCAGAA
TACATGGTGAGCGACAGCGAATCGACGGCGACACGGTCGGTATCCTCCGTATGGAAGACCTTGGAGAGGTCACGGATCTGCAGACACGTGCCGTTGCGTT
CCTGCGCCGCGAGCGCCGCCGTGACGGGCTCAACCACGGGTCCATTGGCATCAGCGGGTCTCTCCACGGGCCGGTCTTGAGCAGCGGCGGTCGGCGTCGA
GAGATCTGCATAGTCTGAAGATGCCTGGGCAGATCGCTTCCCCACCCAGTACGCCTTTGTGAAGAGGAAGTTCCACTTGCGCGTGACGCCATGCTCCTGT
GGCACGACCTGGTCTAGGTACCACCCGAGCAACAGCAACAGCACGATATCCACGACTAGCATGCCACACATGGCAAGCGGCGTCGGCACTGTTACGGGCC
GCCTGGCAATTGCCATGTCATAGGCCATCCCGGTACCCAGTTGTGCATGGCGAAGCAGCGCGTCGATTGCCAAGCCCAGCGCCGTTGGCGGCGCCAGTGC
TGCCGCGTACTTGACGGCGTTCCCCTTGGCCTGCACGCCAAAGTACGGAAAGTACAGCACGATCCACGCGAGTACCGATGCGATCGAGGCCGTGCGCGAC
TTACGGAAGAGCGGCGTGAGGAAATAGGCAAACGCCGTGATGGCCATGCTCAAGAGAAAGAAGAGCCAGACGAGCACAATGTTCGAGCCATGAGGAAAGA
CCTTGGTGTACTTGAGCAACGCTGCCATGGCAAATGACAGCGGCGTGGCCGTGACCGCGGTTGTGAGCAGCCACGAGATAATGACGGCACGGTCTGAGAG
CCCCATGATCTTCATGATCTCACGGAGACGGGCCTCCTTCTCCATGACCATCATTGCAGTCGTGCGCGACACGAACTTGATGTACACGATGAGCAAAAAG
AGCCCGACGACCGTTTGGCCGTTGGCGTAAAAGGTCCGCTTGGTGCCCGACGGCACGCCCAGGGTGTCGCCCGTGTCGGCGTTGAAGTTGGTGCAGAGGA
AGCCGCTCGCTGGAGTCGTGATCTGCGCCGTCGCGCGTTCGACCGTGCCGTCGTCAGGCCACGGGCCGGTGCCCCAGATGATGTCGTCAATGTTGGCGAT
CACGACGAGCCCACTGGTCAGGATCAACGGCAGCAAGATCTCCATGGTGAATGCCACCGGCGTCGCACGCTTAATGCGCACGTTTTTCCACACGAGGTTG
GCGACTTGCTGCCACGAGAGGAGCAGCTTTTCATATCGGGAGTGGCTGGTTGTTGGCGCGGGTGCGAGCGCCACGCCACTGGCAGACGCTCGCTCCATCT
CGTTGGCATCGTCGGGACTCTGTTGGCGACGATGGGACCGCAGCAGACGACGCGTCAGTACCACCAGCACTGTCAGCGCGAGCACGAGGAGACCTGCCAC
GACCCAGAGGGACACGGTGGGCGCGGACACGGCTGCGCAGTCGCTTTTCAGGCCCAGCATCGTGTTGAGCGTGACTGTGTAGTTACGGTACGCCTGCGCG
GACGGCGAGAGTTTGCACGTGTCGCGGAACCGCGCAGCGGCGGCGCAGCACTGCGACTGCGAGATGTAGTTGGGCGACCCGCCACAGGCGAGACGGCACG
AGCCGAGCTGTACGTTCGGGTCAACGCCGAGCAGCGTCGCGGCGGCGGCAAAACTCGCGCTTTCCTGTCGCCCTCTGACTCCACTGTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTCGCCACCCCGGAAGGCGGCGAACACATCAAAGTCGCCCGCGAACTGGAAGAGCCCCGAG
TTCATGACGCACTGCACGTAGCGAGGATCGTGGACCATGAGCCTCGTGGCGATGGTCGTGATCGCCGGGATAAATAGGGCGCCATCCAGGCTGGTGCTGC
CCGCGAGCTGCGCGTCCGTGAGCAGCCCACTCGTACTAATATTCGCCATGCTCTCCAGGCGCCTGCAAATCGCGTAATGGCGTCCTCGGAAATCATGGAG
GATGTTGGTGGCTGACGCAGCCTCTCCTCATTGTGGGTACCAGTACAGTATTGTGGGTGCGATACTGCGTGGTGGTGGCCTCTTGCCATGCGCCATTTTC
GCGTAAAAGGTTAGTTTGTTGTGGTGTTGTCCATTGACTCATCAACCGGAGCTCCTGGGAAAAATAAGTGAGACACAGATCTCGGTTTCCTACCAGTACC
GGTAGGATACCGGTATTCTGGATTCTCGTGCTCTGATTCCAGGTGCGGAATCAGTCTCAGATAGAAGGCTCGTTTTTACGACCGATCGTTCGTCGCGAAC
TTCACACAGACTGATCCTGTGACAATCCATAAAGTCATTTCTAAGCGACAGCAGGGTGATGGAATGGCAGCGTAAAAACCTGTGAGAATCGATAAAGAGA
ACACTGGCGTGTGTCTCGCGCTTGTCGCGAGAAGCGCTGTTCCGTTCTCTGAACACATGTGCACCCACCAATCGGAGAGACGACGTGCTTACTTACTCCT
ATATGTACAAGGCATTCAATTCCAAGGGTTCCATAGGTCATCTCTCCGTTCGTGCTGAGACCATCCAAAATCAGTAGATACGTCCCCCACGTAAGTGACC
TGGTTTCTCCGACGCCCGTGGGTACGTATCGGCGTTGACGCATGCCATTGCACCGCGCGTTCGATAATCGTCTATCCCTCCATTGCACCAGCATCAACAT
CGTCATCACCAAGAGCTCCGTCCCCATTCTCCAATCCCCTTTCGCTCTCCTCTCTCTCTCTCTCTCTCTCTTCCTTCTCTCCATTTGATGCCGCCGTATT
CGCACTCGGTGGACGCCGTCCAAGTCTTCACCGTCGATGTCCCACCCGCCGCGCCAGTGGCGACCAAGAACCCCGCCATTANNNNNNNNNNNNNNNNAGT
CTCGGCCCGTCCGATTCGTCACCGCCGTCTCGTAGTGAGACGGAAGTTGATGACGCGCTGCCGCGCAAGATCAATCGCTGGCAGCAACTGCGCCAAATGG
TGCACACGCTCACAGGGCTGGTGGTGGAGAGCGAGGCAGAGTCGACTACCCATACCGTGGTACCTAGTCGCAGGCGACGGTCGCGTCGGAGCCTCGGCGG
CCACAGTCCCATCTTGCTGCTCCACTACGACTTCTGGCTCGAAGCGATCGATGAAAAGCATCGGTACGGCTTCCACTTGCGCGCGTTCCACGAGCTGTGG
AAGCGGGAGATGGCCGACGCGTCCCCCGTAAACGACGCCGACCGGTCATTCTTCTACTGGCTCGACCACGGCAACGGCAGTCGCATCGAACTTCCGCACT
GCGACCGCAACGCGCTCAATGCGACGCGTGTCCAGTACTGTACAGTACCTCAGCGCCGCCAATTTGAAGTCGAGTTTAACAGCACGCAGCTCACGTACGC
CGAGTCTCACGTGCCCGTCCAGACCGACGCGCTAAGTAAGTGGATTTTCGTGCTTTCCCAAGACGACCGCCTGTACGTCGCGCGCAAGCGCAAGGGCTTT
TTCCACCACTCGAGTTTTCTCGGTGGAGTCCCGGTCGTCGCCGCCGGCAAGATCTACGTTGCGGACGGCAAGGTCTACGCCATTGAGCCGCACAGCGGGC
ACTTCAAGCCCCGGCTGGAGAGTGTCACGGCCGTCTGCCGTGTGCTGGAAGCACACGGCGTCGACTCGCACCGGGTCCACTTTATCAAGCCCAGGAAATG
GAAAGATCCATGGCCATTTAGCGATGCCCCGCACGAGACAGTAGAAGAGGCCGACATTGTCTCGGACTCGGAAGACTCGGGAGAATAGCGTAGTCATAGT
TTCATTAGATCAGCTCCTGTAGTTAATATTTATTTTGCCAGCGAATGTTCATACGTCCAAAAATGTTCCTAGTTGTGATAATTCAATTTCGTGCAGCTGA
TCCGTGATATATCACTTTGTTGACTGTTTCGTGCGGACATTGTTCGTCCCGTCTTCTACTCTTCGTCATCGTCAGTATCGAGCATGAGGTCTTTGACGCC
GCGGCGGTTGAGTCGCTGGTGGCGCTGCATGAGCATGAGCCGACGGCGATCGCGATTGTGGTCAAAAGCGTTCTGGTCAAACACCTCCTGGCGGACTTCA
TTCTGGAGCGTGCGCAAGATCTCGGTCATTTTCGGACGGCGCTTGGGGTCGGAATCCAGACAGCGGGTGATCAGATCGCGACGGCACGGACTGCAGCCAC
CCGGGATCGTCGGTCGCAGAGTGCCTTGCGCGACGTGCACCATGATATCAATGGTGCTTTCCTCCGTGCGG