Description :
From Genome Similarity Track
Location :
Scaffold_616:1185- 5454
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_616-snap-gene-0.6Ras-specific guanine nucleotide-releasing factor
Pytap_DAOMBR444snap_masked-pag1_scaffold_616-abinit-gene-0.14Ras-specific guanine nucleotide-releasing factor

Sequence
4269 bases(100 bases per row)
ATACCCACTCATAACACGCAGGCTGGGTCATCGACCGCGAGCGATTGCGATGGACGACTTTTTGCATACGGAACCACTGACGAATGCCAAAAGTTCCCTC
GGCGCCGATGGATTCGCGAACTTCGCCGTCAaTATCCCGAGCATTTGGATCCACGAACGTCgCCCGTTCGCCAAGCGGTGCAGCACCCGCCTCGCGAGGT
TCTAGCTGCAACGATCTCGAATATCGACTTTCCTCGTTCGGATATGGCAACTCAACGTGAAGAATCGCATCAACGTCGTCGTGGAAGCGGAGATCGTACG
CTACCGACCGACGTCGCAGAATCTCCACCACGAGCTCTCCCAGCTTGCGTAAACGGTTGCCGTTGACAAGTTCGCCTTTGTCAAACACTGGCAACTCATT
CAGACCAACAAATCCCTGTGCATTGACCGAATCAATGAGTGATTTCAGCCAGAATCCAAGGCTCAGGTAGGTAAGCTCACCTGAAGGTAGAGGCCGATAT
ACGGCATGCTTGGGTTCTCGGCGCTGTGCATGATCTTGTTCACCTCTCGGCATCCTTTGtCTGAGAGACGCTGCATCTGATTAAGTAGCTTCTTCGACGC
TACAGTGAGCTGCAAACACACGACGGCAAGTTAGTTTTCCACTGGCACTTACTTCGCAAGATTCCTCCTTACGCAATCCAAAGTATGGCGTAATCTCTGC
ACTGGAGTAGACTGCAACGCGTAAAGGATTGCAGCCAATGTATCGAAGTTtCGCAATGACAGACACCATTTAGCAGCCTGGTCACGAAGAGCGTCAATAA
ATTGTTTGTGAaTTGTGCCACTACGCCATTCGTTACCGAGAGAAAGAACTTGATTACTTCAGCGCGACCTTCTCGTGTGTCTTCGACGAGAATCGCATTg
aTCACGTAGGCAGTGAGCTGTCATGCGCAGTGTTTTtGTTAGagaaaCGATGAAACACTCGTTAGGCGTTAACGTACGTGTTGGAACCACCGTTTTGCAC
TGAGAAATTGTCGTGAAGGAAGCGCTTTGGATCCGACTGCAGAAAAGTCTTCAACTAACTCAcGAAAAGAAAATCAGACTCCACTTGGCTCAGCACTGAA
TAAGGGGTCGTACCTGGGATACTGCAGAAAAGTGTGTGTGTGAGCacTGTGCAGTGTTCCGCCCACTGAGACGGCTCCACTTGGCTATAATGACGAAGCA
CACCAGATCAGCAATCACGTCTCTTTCAAGTCCCTTCAGGTCGTGACTACTGTAGTACTCACATGATCAAATTCCTTGGAAACACAGTTGCCAACGCCTC
CTCCTGCTGGAgTCCATATCGCTGCTGCATCACAAGTGGCGTTGAGGCATAAaGTTCAAGACACGtGGCACTTCCTCGCAACaCAAAAAGGTGCTCGAAC
ATTCGCTTGTAGTCATCCATCATGATGAACGCTTTGTAcGACATCAAGCGGCGATGTCGTTCCAACAGGTCGCGGATTTCGCACAcAATCGGATCGCTCT
GACTGGCATGTCGAAGCTTGAACAGTAgtAGCACGACAaGGAAGCGTAAAaTATTGCGGCCTTTGGAGCCATTCGAAACATATTCGCGTAGCTGACTCAT
TACagCGTCGAGACGGCCGAAAGTCTCGAGAAAAATGACGAAAGAGACCAAGTCTGCTAGATCGACGGAGACGTCGTGCACAAGTGAaTGCAACATCTCA
TCGAAcGACCTGGATCGCGAGTGGgAAGGGGGATCGATGTAGTGATGGTGGTGGTGTGACCcGCCAGCCcTCCCCCACATCCGACGTGGGTCGCGAACAC
GGAGGTGTGCCATGTCGTTACCCGTGAGGTTGTCCAGAGAATAGTCACGTGCTGTACAGCCAAAGATGTCAACAAACTGGTCTCGTTCGGTATCTCCAGG
CTTGAAGAAgAGTCGGATACGCCGGTACAACGAATCATCGTTCGCGAGCTGAGCgaGGTGCAACAGGTGACGACCTAGCAGATCTGGTTGCGCCACATTG
CAACCAGCTCTAGCGAGGATGTCGACACAAGCGCGGATCTCGTCGCTTGTCTCTCCAACTGGAGCATGGGCAAGAAGAACCGCTGCAGGGGTTTGGCCGA
AACGGTTTTGGATGTTGACGTCGGCCCCAGCGTTCACAAGCATTTCAACAAGATCAGCATCTGCGTTGGCTGACGCGATGTGGAGTGCAGTGTCGCCGTC
GAGTGCCGTATGGGTTAAATCAGGATGCTTGGAGAGAAGAAGCTCGACGATTTCAAGGGAACCAGCGTACACGGCATATTCAAGCGCAGTGAATCCGGTC
GACCACGCTACAGtGCTCAAATCGCCACCCAATGCAAGCAGCGTCGTCACACCTTCCATCGAGCCTCGTTGCGCCATTGCCATGAGAGGCGTCATACCTT
CACGATCTCGAGCGTTGATTTTGGCACCTGCCTTCTGCAGTtCTTCAaCAATGCTCACCATGTCGAGTGTGGAGGACGACAGcACGTGCAGTGGTGTTCG
CCCGCAGCGATCCTCAAGGTTCGGCTGAGCTCCCAGTCGCAGCAAATACTCAACCATCACACGATAGCCCATCTCAGTCGCTCCGTGCAGAGCGAACTCA
TTCACTAGAGGCGGCTTGAAACCCAGCATCTGGAATCCCCGTGAGTGTTGCCATACACATGGCTCATTTACATCCAATTGCGAGCCAATGAGCCAAGATA
CTGAGTCTTTGTCTCCACGACTGGCAGCGAGGCACAATAGATACTGGTACATCTCGCTGTCGAGCGAGAGCATCTGGTAGTAGAAGAACTCGGGTATAAA
CGTGAGCTTCTTGGGAAGAGATGCCGAACGAATTCGCAGGATAATGTCTCGGAATGACATGAGAACCACGGGCTCGTCGTTGATCGCAATCAGTGATAGT
CCGGGAACAATGACTTCACTTAGCGCTGCCTGAGACAGCTTCCTCACAGAATGCACAATCGCACCTCGGCCGTTGCCgTCCGTTGTGAaGAGGATTCCAA
CATCcgTAGTTGAAATCGAGACGACGACTCGAGACGaTGCGATTGACACACCATCCACAGACTTCGCATCTTCTGATGATTGGTAAGAATCGATCCATGA
GATGGCATCAAGGAACGCAGCCACAATATCAGATTGGTTTTGACATGCAGGATGCTGCTCGTAGATCGGCTGCAAAAGTGCCCGCAGCGCcGCCAAATCG
TCAACCGAGCTATGGACGAGAACGTATCGAAAGATCGCAGCCATTGTCTGGTCAGCGACCTCAGCCAGTGCACCGTGGCGGCGAGCAACACGAGCTGCAA
TACTACCGCCGGCATTGATAATCAGATCGATCTTGTGCGAGGGCAGGGACATGCAGTCAAGGCTGTCAATAATCGACCGCGCCTCGGCCCAGTCCGTCGA
CATGTCGGCGACGTCATCGGGAACgCCAAGTTCACGCTGGGCTTTCGTTTTCAGTAGCTTCAAGTGCTTTGAGATGTGAGAACGAGACGTGCGGACGGAC
GAGGTGTCGAGATTCGAGTACACACGACTTGCAACAGGAATAAATGCTCGGTCTTCAATGTGACGGCGCATGAGCTTGACAAGTTCGTTACCCGACAGCA
TTTCCACATCTGGATCTGCATACAGGTATCGTTGGTACCGGTCCATGATAGCAGCCTCGAGACGCTCGACAAACTCGTAAACCATGCCCACACTGTGCGG
TACGATTGATGCTTTGAACGCTGCCATCATCGAcTGAATGCGGTTATCCGTCACGAAAATCTTGTTGAGCTGGCGATTCACGGCGAGCCCACCAAACTGC
TCTTCATGCACAGTGAGAAGTGGCTCGAAGCATGGCGGCGAGCACTGGCGCACTTTCCGGAGTGCATTGACCCATAGCTCAGCTTCCAGTTGGCTACAGC
AGCAACACCACATGCGGTAATATCCCTTCTCCACTTGGAACACGTAGGCCTTTGTCGACCGCCGAATGTCGACATGCTGCACCGAGACtACACCTTCGTT
CAACTTCATGCAGCCTTTCATGCGCCGCTTGCCCTTGGCCTTGTAATACGCCAGTGTGCCATCGTGGAATAGCACGAAGAAGCGGTTCTTCCAGTTCTTC
CTGTACGCGAGTCCTCATCGTTACATCCTCCGAGCCTCCGTCCGCCACCACGTCGTACGTACCACACGTGGCCCTGCTTTGTGAGCCAGCCCATCTTGAC
GTAGTTGCCTGTCTCGaCCAGGGATGCGTAGTATCGGTCGTTCAAGTGCGGGTCTGTGCCGTGGCGTGC