Description :
From Genome Similarity Track
Location :
Scaffold_650:1185- 3455
Sequence
2270 bases(100 bases per row)
TGATCCGTCGGAGCCAGCGCGGCGCCGACTGTCCCCGCGGGCCCGATCCCGATTGAGCCGCTTCCGCTTACACGAAGGTTTGCTGACTTACAGTGTGGAC
AACGAAGACTCACCACGCATCGTCGTCCCGCTGGACGACGATCTTCGCGCCCGATTGATTCACGAGTTTCACGATTCTCCCAGTGGTGGCCATCTTGGGC
GCGAAAAGACCTTCGCGTCCCTCTCTCGCGATTACTACTGGCCGCACATGTACAAGTGGGTGCGTAAGTGGGTTCGCTCATGCGAAGCGTGCCAGCGCGT
GAAGCCTTCCCCGTCGAAGCAAGCACCGCTTCGACCCCGCCAGGTGGCCTCGGAGCCGTGGTCCTCCGTCAGTATGGATTTCGTTTTCGGCCTTCCCCGC
GACGCCCAAGGTCGCACTGGCATACTCGTCTTCGTCGATCGATTCAGCAAGATGGTCCATCTTGCTCCAGTCGCCGCTACGGTCACCGCCAAGCAGTCTG
CGGCGACGTTTCTGGATCTTGTTTATCGCCATCACGGCTTGCCAACATCGATCGTTTCCGATCGCGATCCCCGCTTCACCTCAGCTTTCTGGTCAGAGAT
CTTCCGGCTTGTCGGGACGCGGTTGAAGATGTCCACCGCGTCGCATCCAGAAACGGACGGCCAGACGGAGCGTGCGAACAGGGTCGTTGAGGACGTGTTG
CGGAGCTTCGCCACGTCATTCACGTCCTGGAGCTCGTTCCTTTCCATGGTCGAGCTCGCGATCAACAATGCGGTTCACGCATCGACGAAGCTCACTCCAT
TCTACGTGAACTACGGACGCCATCCCCGCGTCCCTGCCCTCCTTGGCATGGATCGTCGGTCCCCAGTCGAATCGGACGCGGTCACGCCCGCGCCAGTACC
CCCACCGAACGAGACGGACGCCTACGATGTTGCCCCATCCGCGATTCCCGCTGACGATAGTCGTGAGCAAGCTCACGACGTCACCTCCGCGATTTTGAAT
GCTGTCACCACCCGGCGTGGAGCCGCATCTGCTGCGCCAAGTGTGCGCACGCGTGGTGCCACGGAGGCAACACCATCTTCACTGACCACCTGGACGTCCA
GGACGCTGATTAACCCGCGTCAGCATCGCCGCGCAGTTGAGTACCATGCCGCGACAGGCTCAGCCGCTTCACCCGAGCCTCCGCCCGCAAACTTCAATCC
GAACCCTGAATCGCTACCGCGTGACGCCGCGGCCGCTCTTGCATTCGTCCAGCGTCGCGAGTCGGTAATCCGCTATGTGCGCGACGCCATCGCTATGGCG
GTGGATCGCCAGAAGGAGAACGCAGACAGGCGTGGTCGCAAGAATCTCGCGGCGTTTGCAGTGGGCGATCGTGTTTTGCTATCCACCGACGGCATTACAC
CCACTTCTGTGACGAACTTGGGCGCCAACAAGCTGGCGCCGCGATATATCGGACCGTTCAAGATATTGAAGGCATTAGGTGACGCGTATACACTTCGACT
ACCTACAGCACTACGCCTCCACCCTACCTTCTACGTTGGTCGCCTCCGCCGCTATCACCCTTCGTCTATCCCCAGCGACGCGGATGGTTCCCCGCGTCCG
GACTTCGGCGATCATCCCGAGGCTCGTCCTGACGTCGCACGCAATGGCGCAGCTCTTGATTCTCCCGCTCCAGATACTCCACACGCTGAAGCAACCGATC
CAGACGCTGCGCGGTCGCAGCGTCTTCCCGCCGTCCGCGGTCCACCCTTTCAGCGTGACGGTCCCGCTCCTCTTGTCGATAGCGCGGGTAATCTTCGTCA
TATCGCTGACCGTATCTTGGAACACGAGGACCCTCGTGCTGCGCCCAACCTTGCTCATACGAGTCACGGCGCTGATCGGCATGACGCTGCCATCCCTCCG
CTCCGGCGCTACCTCGTTCGGTGGCTCGGACCCATGAAGGATAGTTGGGAGCCTCGCGCCATCCTTCTCGCCGACGTTCCGGACTGCGTGGCGGAGTACG
AGGCTGGTCTCGTACCGGCGGCCGATCGTCACGCGGGCGCGGCCGTCCGCCGCGCCTAGCCTCGTCGAGGGCCCTCAAGTAGCGTCCTATCACACCACGC
TCCACTTCGGTAATTGCAGCAGCTTCAAGAACACGACCCCATTCTGCGTCGCCGGGTCGCGAGGCACCACGCTCGCGACAACGCTGACACCCATCTTCTC
GGTGTGCGGTACAGCACCGGCGGCCTTGGTCACTGGCCAACCTGCAAACTTGAGCGGCCAGCGCGCTGAC