Description :
From Genome Similarity Track
Location :
Scaffold_114:11846- 13307
Transcript NameFunction/comments
Physo_142402hypothetical protein

Sequence
1461 bases(100 bases per row)
GACCAAGCCTGCGAATCTTCGTCGTCGTTGCAGAGTCGAATGCAGCAGCCGAACGTATGGTCGGGTTGCCGTTCGACTTCCAGTCGCTGAGCACTTTCGA
TACTTTCGTGTCCTCATCCGTGGTGTTGAAAACGTAGGCGAATGCCTTGTTCGTCGCCGCCTTATTCCAACTGCCACGATCGAAGATCCGTTGAGGACTT
AGCGAAGCATCCGCGTTGGCATGCTGCGCACCGCCCCGCCGGAAAGAATGCGACGAGAGGCCACTTGAAACACCAGCATTAGCTTGACGTGCGCTTGCGG
TCTTGAGCACTCGATTGACGTACCCTTGCATTTTCAGCGGGACAGACTTACGTCTCGGAGAGGTGGCTTCCGGTGATGCATTAGCAGGATCATCATCATC
ACTACCGTGGACGAGCGTATCGGTAAGTAGCGTATCCTCCGTTGCTGGCGCTTCATCTCCAATGTTCAGCCCCGAAAGGTGCTCGAGGTCGAGTACAGAC
GATACCGGGAATGTTTGCATCGCCAGTGCCATGGCGATGGCGTGGAGCGGACACGTGATGAAGGAGCTCTTGTCTGGGAAGAGAGAGAGGCCTTGCTCCT
CCGACGTTTTCGCTCGGATCCGGCGAAGGAATAGCACGTTGCCCGAGCCGACCGACAAGTTGCGCTTCTGGATAAACGCGAGATCGGACGCGCGTCCAAG
CGCGTACCACATGATGGATAGGAGCGCAGCATCCTAATACTCCTTGGCAGAACTCGCATCAAAGTACAGTCCGTCGATCAGAGAACGCAAGTCGGCCTTG
GTGCATGCTGGCGCCTTCGTCACCATACCACCTTGCTGCCGTTTGAGGCTGTGCCGCTCCAAAATGCGACCCATCTTGAGTAGCCGCTGCTCCATAATGT
GGCGGTGCTGGAGGAAATCCTCCAGCAACCACTTCTTGACATTCCGGTAGTAGCTCATCACGGTGTTCCGCTTGCGCAGATCCCCGCTTCGGCCTCGAGC
AAACGCGAGGTTCATCGCGAAGCGGTCGAGCAACTTCACGAGCACCGAACCACTGGCATCTGCCAGGAGGGTAGCGCGGATAAATTCGAGAGTGACATTC
TCGGAGGCGAGGAAAGCCGTGAAGGCGTTGACTGCTGTTGCTTGCGCGCGCTTCGTGTTCTCTGGAGCGAGGTCTTGCAGGCTCATTGTTTTCGAGTCTA
GTGTCGGTTGGCTTCTTGATATCCAGCAAATATGTGAATGACTTGCCTTTTGTATGGCTGTCGCTGCCGACATTGTGCGTCGGCCACGTGTCGATAGCCG
TTACCCTACCCCTGTCGTGTTTTAATTGGCTAAAATTTCTCTTGAACACTGTATGATTCGTTAAAAGGCTTCAGCTGTGTTTCTATTGGCTCACAGGACC
ATACAAAAATCAAGTTTTTAGTGTATGCTGTCGGCAGTTTGATGATATTCATCCATATGAT