Description :
From Genome Similarity Track
Location :
Scaffold_171:118455- 120724
Transcript NameFunction/comments
Phyci_97546hypothetical protein

Sequence
2269 bases(100 bases per row)
GCACGTTAGCTGGGAACTACTTGATGCGGGATACGAACTTGTATTGGCTGAGCTGTTGAAGTGAGCCCTTCTGCACCATAGCTCGGATTGCACGTTGGAT
GGCGTTGGGATTGTAGCCCTGCGCCTCGAGTCGGCTGTACAACGCGCTGGTCTCGACGCGCGTGCCGATGCGCAGGGTGCGGTTGATACTCTGCTCCACC
TCCTGCGCTTTCTCGTGGAAGCCGCCGAACAGTCCCTGAGTGCCGCCGTCCTTGGCAGCATTCATCGTACTCACGCTGAACAACCGAATCGCCTCCTGAA
CGTGTTCGCGCGTGGCCTCATTGCGTAGACGCATCTTCGCAAGGGACTCGGAGATGCGCACAAGAGCTTCGAGCTGACGCACTGTGACGGGGATCGTGGT
TTCACCTCCTTGGGTACGGCGCACATCGTCGCGCACACCAACGTAAAAGTCCTGCAGCGCCTGTGCAGCTCCGACCGACAACCTTGGCGCACAGCGCGTG
CGGCAGTAGGTAATAAACTTCTTCAGCAGCCACGGCTCGAACTCACCACCGCTAGAGGCATTTTCACTGGCGGAAGGTTTTCCAGCCGCCGACGCGAGCG
CATTGGTGTGCATCCGCACGACGTGAGCTGCCATTTGTCTATCCCTGGCGTCGTCCTGAATATCGCGCACGATGAAGATCATGTCGAAACGACTCAGAAT
CGTGCTCATGAGGTCGATATTCTCCGACGCAGAGCGCATATCGTCGTAGCGACCGAACACGGGGTTGGCAGCCGCCAGCACACTCGCCCGGGAGTTTAGA
ATAGTCGTGATGCCCGCTTTTGCGATGGAGATGGTCTGCTGCTCCATGGCTTCGTGAATCGCTACGCGATCCGACTCGCGCATCTTATCGAACTCGTCGA
TGCACACCACGCCACCATCCGCAAGCACCATGGCTCCTCCTTCCAGATAGAACTCGCCCTTGGCGTCCCGGATCACCGAGGCCGTCAGACCCGCTGCACT
GCTACCTTTGCCGGACGTGTAGACGCCCACGGGGGCGATTTTCTCGGTAAACTTCAAGAACTGCGACTTGGCTGTACTGGGGTCTCCGAGCAGCAGCACG
TTGATGTCTCCACGCAAGATCATGCCGTCGGGCAGCCTCTTCCTGGAGCCCCCGGCCAGTAAGCAGGCGATGGCCTTCTTGATGTTCACGGTGTAGTCGC
CGTAGATGGACGGCGCGATGCTGGTCGCCAGCTTGTCGTAGAGCTGCGGGTCCCTGGCCATCTCGTGGAACTTCTCCTCCTCGGCGGGGGAGAAGGTGGC
CTTGGCGCGCCCGGCGCCTTCCTCGTCGATCTCGATGCCCACCACGCGCAGGTAGAGCGTGCGAATGGCCACGGCGCCGACGCTCTTGGCGCCGGCGTTG
ACCACGGACGTGATGCCCACGACGGACACGCGCGTGCCTGGCGACGCGCGGTCCACCAAGTGGCGGTCGGCGACCAGCGCCAGGTTGCGCGGCATCTCTC
CGGTGGGGACGACCTCCGGGTTCTCCTGCAGCTTGAGCGTCTGCTGGTCCACGTACTCGCCCCTGTCGGGCAGCACCACGTACGAGTCCTTGGGGCAGAG
CTCCCCGGCCGCGTCCTCCTCGCGGTTGCGGTCGCACACGCGCGGGATGCTGACGCCGCCCAGGCCCGACACGGCCACGCGCTTGGCGTGGCCGCAGTGG
CGGCAGCGCAGCGTGGCGGCCACGCACTTGGTGCGCACGCGCGTGGCGCTGATGACGATGCCCGGCACCTTCACGAGGCGGTTGATCTCCTGCGCGTGCA
CGTGGCGCAGCGCCACGGGCGCCTGGTCGCTGGTGAGCACGGCCTGGATGTCGGGCAGggcgttggcgttggcggtggcagcggcggcatcagcagcgtc
cgaggcgctggcgTCCTGCGCCGAGGCGACCAGCAGCTGCGCCAGCATCTCCTTGGCCGCGCGCTCCAGCAGCGGCAGCTGCTCCCGCGGGCTCTTGAGC
AGCAGGCCCTGCAGCTCCTGGTCGAAGGCCGCCACGTGCGAGAGGCTCACGGTCACGACCCAGAGCTGCCGCCGCGCGTTGGCCAGCAGCTGCTCGCGGT
ACACGAAGAGCGGCCCCACGCGGAAGCCGCGCAGGAAGGCCAGCAGCCGCCGCTGCAGCGCCGCAGGACTCGCGCCCTGCCTCGCGTCCGACGCCTGCGC
GCTCTCCATGCCCACGGCCGACACGCGCCCGGCGTCCCAGTCCATCGTCGGTCGGTGGCTGCCTGCCTG