Description :
From Genome Similarity Track
Location :
Scaffold_420:11845- 16240
Transcript NameFunction/comments
Phyta_totarag8134hypothetical protein

Sequence
4395 bases(100 bases per row)
AACCGAAACCGCTCATGGTGAGCGTCATGGTCTTCGAAGGGAAGGACGGGGAGAATCTCCTATTATGGACCCAAGAGGTCGAAATGGCTACGAATTCAGC
CATGCTCCGAACCGAGCAACAGCGCGTTGCGCCGGCAATTTCTCAGCTCGGAGGATGAGCGCGAGAGTAGGCATTCACGTGAGGAGCGGCAGTTGATACC
GCTTCCCAATCTGAGAAGAGCTGAAGCGTCAGCTGACGAGAGTATTGCTCGGCCTAACCACGCATACCGCGTACGCTATGACTGCCTGGTCTGCCGTCAA
GGCAAATATGAGTTGGTAACCGATGTCTAAGAGCTACGCACGCTCGCCACTGGCATGTTTGCCGATCCACTACCTGATGTAATCACTGCGACAATGTTTA
TGGAAGGTTTCTGAACCAGGGTGGCACGTACGGAAGTATTGCGAGTCCATCCATATTCTTTTGAAGCGTCCGTCACGGTGGCATTGAATGCGAAGCATGA
CTTAAATCAGCCCGACTTGGTTAGAATGAACCGCACCCAACCCCCTCGGGTGGCCCAGTACCCATGGACCTCAGCTATGCTGAAGGAGAGGAAGCTGAGC
GTCTAGCTGCCGAGCAGCGTATGAGCATCCGGTGATGCTTTACCTGTGGCAGTACTCGCCACTTACGCATGGGATGCCCCCTGCGCAATTAGCACCAGGT
TCAGTAGAGCCAAAGCTCCGCTTTCAACCAGTGCTCCCGGGGAAACGGCGGATCCCAGTAGGCGCGGGGCGGCCAACTGGGGAATAACTGAGTTCTGTTG
CGCCTCGGGGTGGTATAGGTCGCCAGGGCTCTGTCCTGAAGAGATCCGAACTCTCTAACACAGACCGTGTATGCAACCGGGCTTGCTGGTCGTTCAGGTG
ACCGCGAAGGGCTTTGAGACGCCGTGGACAGTCTTGATAGACTCTGGGGCGTCGGGCAATTATACATGGCGCTCCTCGGTGGAAGGAAATCTACTGTATG
TTGAGCACTGGTAGCGCATAGGTGTGACAGATTCACCGTTCGGCTAGCGACGGGAATCCGTGTCGCGGTGCTTATGGTCCCGATGGACCTGGACGTGAAG
ttgataaaggtgttgaggtcttggaagcgaggcttgggctgagcggagggagttNAccggttaatgggtacaactggtacacagtacccaaaaccagtaa
ccctcaataGAAGTTCCTGGCCTTCGACAGCATGGAGCGCTGTCTAGTCCTAGACCTGGATTCGAAGTGTGACTTCCTCCTTGGTAAGGCTTGTCTCGAG
CGCCATGAGCCATGGATCGGCTGGAGGTCAAAAACATTAGGTACTACGCACTTCTCTCCTGGTGGAGCATTCGAGTGATGAACCCACCTCTTCTAGGAAA
CAGAAGCGCTATTGGCGCGAACACAGGGCCGAATCGGCCATGATGTTGGACATAGGTGTGTCCGAGTTGATGGAGAACACTGTGGTCTGGGATGTACATC
CCGAGCATGGTTCGACGGTGCTGCCCTGAGCACGGCTCGATAGAccgacgtggagcagcatgTCATCCGCTGAGTGGCGGTCAACTGGACGACACACTGA
GTGCTCACGCGAGCGCTGTCGACAGAGTGTCGATGCATCAACGACCCGGTACTAAAGGAGCACTTGGGGTGGCACGTATTCTACTGGATCACGGGCGTAT
ATCGCCGAGTGGCTTTGAGGACACTGGTTCCAACGAGGACGGAGGTGCTTCCGCACCTGGACGGGATGACACTGATGTCACTCCGTCGTCCGCTACCACT
CGGTCTCGGGcacagaggaggaggaggagacgctcTGCGTCTCCGACGCCGTCGACACCGGATGAGGTGTCCAGCGTGTCGATCCCCGCAACTGCACTGA
GCAGTTGTCCACACTCGTGAATGGAGTGACGGGAGAAGTCGAAGGCAACATTAGCCCTGAGGCTATCCCCACTGTtggtgttcttcttgagctggacgag
atgtcGGTCGCCGAGTTCGGTGAGGCCTTGGAGACCGGCGAGTTTGCCGAAGTGGTCATGATATGACCAGAGGAGGAATTAAACTCATCATTCCTTGTGG
ATGAGGCAGTCCTTGAGGAtaccaagaagacgctcaGTGCGCGCAGCGGATCCGTGATCCTTAACGATCCCTCGGATCCGGTCTACCCATTGCTGATAGA
GTATTGAGACGTCGTCCACCCATGGGTCTGCCTCCGGATCGAGCAGTTCGTCACGAGATTGACTTGGGTCCGGGAACCAAATACTGCGTAACGAGGCAGT
GACTTCTGCCCAAGGATCAGTGCGACGTCATTAACGCGTTCTTCCGTGCGAAGCACGTGGCTGGTCTGGAGCGTGAGAGTTAGTCTCCACACTCTACACC
GCCAGTCTGTGCCTGAAAGCCAAACGGCAAGTGACGCACCGTGCATGCTTCAATAAGCTGAATGCAGCACCATTCCGGCACAGACGCCAATTCCTCGGAA
GGATGTTCTCCAGAACAGCATGGTCGGATGTACACTGTACAACGCCCTCGATTTGGTCGATGGTTACTACCAGTTGCTCATGACAGCGAGCGATATTCCG
CTCACGGCGGGCAGTATTCTGGGCAGTATGCTCTAGGAGGGGTTGGTGATGCCCCAAGGGCTGTCGAACGCACTGGTGACGTTCAATCATCTGCTGACGC
AGTTGTTCCGACCTCGTCGGGCGTACAAACATACGTACGTTGATGATATATTTGCCCACAGTCGTGCAAAGTCGTGCGAAGCACGGCAAGTCAGATGTGG
AAAATCACATAGAACATCTGcgagcagtgctcgagtgcatgcgcaccagcacgttgtaTGCTAACACGGACAAATGCGTCTTCGACGCGGAAGAAATCCC
GTTTCTCGGGTGGCTCATTGGGAAGCGAGGCCTTCGAGCGGATCTCGCCAAGGATAAAGCTATCGTGGGCAGGCCAGTCCCAAAGTAAGTTCTTTCGGGC
CCGAAAGGACTTACGCGAGTAGTTGAGCCTCGCCAATTACTTGCAGAAGTACAGCGAGAATTATGCTGAGATGACCAGGCCACTGTCGAATCTCTTTAAG
AAGACTACTGAGTGGTGTTGGGGCACTGAGCAACGTCGAACCTTTGAGGCAATAAGAGAGCGTCTCCTTCAGGCGCCGAACCTGGCGCTCCCGGACCCGG
ACTATTCGTTTAACGTCGTGTGTGACGTGTCCGACTTTGCTATCAGTTCCGCTTTGCTTCAAGCGGATGTCGAAGGGCGCGAATGCGTGATCGCATTTAA
GTCTCGGCAGaccaaggctgctgagaagaACTACCCAGTTCATGGCAAAGAGCTACTCATGATGAAGTATACTCTCGTCAAGTACAGTGTCCACCTGCTC
GGCTCCAAGCTTTTCGCGGCTTACACGAATCACGAGTCATTACGCACTGCGACTCAGTCGCCTCACCTCTCTCAGAGAATGGCCCGATGgctctccttct
tggcggaGCATAACTCCGAGTGAAGTACAAACCGGGCAAACAGAATACCTTGACCGATGCGTACCGGATTATGGGCTTGCTCATGTCACAACCGTGAAGT
CGGCCGTGACGGAGCTGATTCGTGCAGCTTACGCAAGCGACGACACCTGTGTAGCTCTGCTACGTGCTCTGGGGAACAAGAAGTTCCCAGCCTCGGATAT
GAAAAATTCGGCGCGCTCTCGCGCTAAACTACATCGCTATACGCTGGTAATGGACTACTGTATGGTAGCACAGGTACAGCCGACGTGCCTCGCGTGTGGT
CCACCATGTTAAGGACTTGAAGTATCGCACCCTCTCGGAGGCCCATGATACACCACGCGGTGGACACCTAGGTCGTGGGAAGATCTCTAGCGCTGTCAGC
GCAATGTACTGGTGGTCGAAGTTGTACAAATGCCGAAGTTGTACAAATGGGCCAGCACATAAGTGCGCACGTGTGAGATGTGGCAACGGGTGAAACCCTC
ACCGCATACGATCGCGCATTTGGCGAGTTTGCCTGTCCTTACGGGGCGTTGGCAGTCCATGAGTATGAAATTTGTATTTGGCCTGGCGAAGGACTCGGCG
GGCAAAACAGGCATCGTGGTCTTTGTGGACTGACTGAGCAAGATGGTTCACGTGGTGGCTGTGCAGGACTCCGTGGACGGAGAGGGTACAGCAACGCTGT
GACTTTCGACAACATGGCTTCCCAGAAACGATTGTCTCGAATCGAGACCCCCGCTTCACGGGGAATTTCTGGAAGCGTGTTCGATGTGCTGAGCACTCGT
TTGGACATGTCCACGGCGGATCTGACCGACAGTCAAACCGAGCGCGTTAATCGCGTTATGGAGAACGTCCTCCGCAGCGTGTGCGCTGAAACGCC