Description :
From Genome Similarity Track
Location :
Scaffold_196:11844- 13884
Transcript NameFunction/comments
g19381.t1hypothetical protein

Sequence
2040 bases(100 bases per row)
TCGACATTGCACGAAAGGAGGACTACACACCAAAGGAATCAGTACTTGAGTTTTGGCAAAGACTTGAGCACCAAGGCGACTACCGTATCATACCGAAAGC
TGTGAGAGTGATGTTCTCGATACCAGTATCTTCGTGCCAGATTGAGCGTGGTTTTGGTGTAAGCGAGCAGATGGTAACTACACAGCGCATGACGTTAGCC
GAGCACAACATCGATATGTGCTCATTCCTGAACAGAAACAGCGAATTCGTTGACTTACTGCAGTGTGAGGAGATCCCAAAGGGACAACAAGACTTGCACA
CACCTACCAGCTTCATCGTCCCCGTCGCTGAAGAAATGGACTATGATCTGGACGAGATGACAAGCGACCTTCTGACCGACTTCGCTTCTAGTGTATCACT
ACCTGCCGACTTTGAGGAAACGAAATCGGAATGGTGAATGTATTAAGAAATCGACAAAATGACTAGTGAGTGAATTCATACACGTATTACGTTATGCTTT
CCGTTAACCATCTCTCTTTGCTACGCTTACCTTGCCCAGCCAGCTGCACTTGAACAACGCTGCAACATTCACGTTCCACTGCTCGACAAGTAGTGTTGGG
CTGTCTGCTCCGCTCTCAATTGCGCTTGAAGATGAAGCTCTGGCACGGGTACATTTGCGTCACCTGTTGGTGTGCTCAATGATGTGTGTGCCTGCAGGAG
CTCGAGCACGCTCTCGAAGTGACTGCAATCGCACAAGGCTGGTGGATGTCGGCCGAAGTGGTGGCGAATATCCTTGATACTCCTCGGTTTGTAACGAAGC
ACGAGTCCCCGCTACCACTGCCGTGGTTGGCCTCGCAACCACCACCCTATTCGATATGCACCGCTTGGGTGATGTCGTCAGTGGCGAACTAGCTCCTTGT
AGTGTCTGTGGTGATTGATCCTCTGTCTGTGTCGCAGCACTTGACGCCAACGTAATGTGCACCATTGCCACCGAGTGTGTCTGATCCCTCTCCAACGCTA
CAGGCACCTTTGACTCATCGTCGTCAAGGTTGCTTGGTTCTCATGTTCTGGAGGTGCTTCACGGCCATGGTCGTTTTGCCAGCATAGAGCTTGAACAGGG
TTTTTCCTGACGTCCGACACGCCTCGTCGGCCAAACAAGCCCACGCGAAGACCTCCTTCCCGTTCTCGATGTACTTGACACGAACCCCCCACTTGAATAT
GTACGAAGTCTCCTTTCGTCGTGGAGGCACCAACTCGAAGGGTCCAAGGGCCTGAAACTCTTTCACTGCTTGGCGGACCACAGAAGGTGGCTCTGTCATC
GTCACGCGTTGGCTGGAGGTGTCGTGGGTCCCTGCAGATGTCACGAGTGTGGACTGAATGTGAAGTAAGTCCCCGAGGCGGTCTCTAGTCTTGTCGGCTG
CGCTGTGAGCTCGATGCTTGGCGGCGGAGCCTCTGACCTGAAGCCCTTGGACTGAAGCTTGGACTGACGGCACAGTGAGTCCCTGCGGTGGCCACGAGTG
TGGGTCGGAGGTGGATGTAATCCCTGCACTGCTGCTTCAGGCGGACCTCTGACCTTCTCCTGAAGTCCTTGACTTGATCCGTGTGCTGGGAGGTGCCGTG
GTCCGTGCGGTGGTCACGAGCATAGACTTGCGGTGCTCGGGGTCCCTGGTGGGGTCACGAGTCTATCGACTGCGCTTCGAGCGCGTCGGAGGCTCAGCAC
ACGCGAGCGCAGGCCGCGTCTTGGGCAGAGGATATCTTCGCGAGTGAGCTCGATAAATTTCAGTGCGGCCGTGGAAGATCGTGCGATTTTCAGCCAATCC
AACACATAGGATACGAACACGCCAGATCCGCTTAAATACGAAATGCGCGAGAACGAATATCGGGAGGGAAGCTCGCAAAAATGTTCGTTGTTCTCGCACT
TTAGCGAGGAGAACACGAAAATCACGTTTTTCATGTTCCCTCTTTTTTGTGGAAGCGTTTTTCACCCATTTTTTGTTCCCCTACCCGCATGTTCGTCCAA
GGCTTGGCGATTACTAAGGCCACGATTACGGGACAAATTG