Description :
From Genome Similarity Track
Location :
scaffold_12:118429- 119850
Transcript NameFunction/comments
g769.t1 polyribonucleotide nucleotidyltransferase, putative

Sequence
1421 bases(100 bases per row)
TGCCAAGACTGCGGTGGCTTTATCGTCGGGAATTTCGTCAACCTCTTCATGTTTCATGGAGGCTTGAAACGCGTCTAGATGCTTGTCAAGACGTGCCTCC
CTATTGTCAAGGCGTTTCTGGTTCAATGAGTCCACCCCAGAGTCTGATCCTAAACCAGATCCAATACTCCCGATGTCTGTCGGCAACCCATTGTCAAGCA
TGCCCAGTACCGCTGCAGGAGCTTCAACGACATTGGTGATTGAGCCAACGATGAGGTCGAGAATATCGCCAGCACTGCTGATATCAAACTTCAATATCAC
TTTGGCGAGTTTTAGTGCAACGATTATCAGCAGCACCGACCACGCCCAGAAGATGCGCGTTATCCGCTCGCAGTACGATTCGGTAACAATGGCGTGCGTG
ATGTACTGCTTGATGAACGGCGCTGCAGTGTGGACTTCTTCCAGCAAGTTGTTGTGGTGCAATTTGTTTCTGCGCACAAATTCATTCCAAACCAACTGTT
GTCCCCGTTCGGTCTTGTTGATGGTTCTCTCCAAGTCGTTCATTCTGGAGTCAGTGAAGTAGTAAGTGCCATCCTTGACCATCGTGTTGATGCAGCGCAC
AATGGCGTTGACTCGCAAGTTGACTTTAGCAGCAACTTTCTGTTCCCAATCCGCTTTCTTGCGATCGCCTTCGCCTCGAGAAAACCATCGACCGTTCTTG
GCGACCACATCGCCAAGTTTGTAGGCATCCCGCGCACCCCAGCAGAAGATCGCACCAATGTACCTATCCCGAAGTCTCTCGAACTGTTTTGCGTGCCTTT
TATCGATTGCTGCCATGGATCGCTGGAGTACTCCAACCACCTTTTTCTGTTTCTCGATGGACTGCAACTTCAATATTTCTTCCACCGCACGCACGTCCGT
CAGTTTGTGAGCAATTCCGTGCATCTGTATCTGCATTTCTGCTATCGCTTTCTTCGCCTTCTTGATTTCTTCACTCGTGAATCCCTTTCGTTTCATCCAG
CAGTAAAACTGAGACCGGGTCACAACGGGGTCTTCTTTATCGAGTCGACATGACACCACGAAAGCCTTAATACCGCTTATACAGTAGGCAATAAACTTGA
AGGGGGCCAGGATGATCCACGCGATAAGCTTAAAGAGAAGCGTTATCGGCAGGAAGATGGTGTACATGTAAGACGGGCACTCAGCTTCTTCTTCGACCCG
CGGTCGTGGGTATACGCGGCGATCTTCCGTCCAGTATGAAGTCCACTCGGGTTTGAACGTGACAGGTAGCTGCTTCATGAATTTGCCGCGGCAGGTATGC
ACCTTTCTAAACGTGTACGACTTGGGGGTGTCTTCTTTAACAGAAACTGCGACATCGACAGGAGTCACGATACTCATTCTTCCACCACTCCAAGTGTTGG
AGAAATGTTTCACTGTCGCCT