Description :
From Genome Similarity Track
Location :
Scaffold_33:118428- 121141
Transcript NameFunction/comments
Hyaar_Emoy2804922hypothetical protein

Sequence
2713 bases(100 bases per row)
TGAAGGCAGGACATTTATCCGAATTAGTGGTCATTAGACCCGATGTTGAGTTGAACTCGTCCTCATTAATGGATGAGTCGGTACTAGAGGATAATAAGGC
GGCACTCAGTGCCCGGAGTGGATCTTCGATCCTTAAAGATCCTTTGGATCCATTCTATCCTTTGGTAAAGGAATTTCAAGAAGTGGTGTGTCACAATCCA
CCATCTGTCTTACCTCCCGCTAGAGGTGTGCCACAACCCACCCTCTGTCTTACCTCCCGATAGAGGTATACATCATGAAATTGACCTAGTTCCAGGAACT
AAATACTGCGTAACACGGCAGTGGTCTTTACCTAAGGAACAGTGTGACGTCATTGACGATTTCTTTCGTGCTAAGCACGCGGCGGGAATGGTGCGGGAGA
GTAAGTCTCCCCATTCCACACCTACTTTTTGTGTCAAAAAGCCTAATGGTAAGTGGCGTATTGTGCACGCTTATAATAAGCTTAATGCTACCACTATCCC
GGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAATAGTATGGTGGGATGTACATTGTACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGCTG
CTCATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAGTACCCCGAGCGGTATGCTCTGGGAGTGGCTCGTTACGCCACAAGGGCTGTCAAATGCCCCGG
CTACTTTTAATCGTCTGGTGACGCAACTATTCAGACCTCATTGAGGCTATGCACAAACGCACTTTGATGACATCTTTGTCCATAGTCGTGCAACGACCAG
TCGATCTGATGTGGATAATCGCATTGATCATTTATGAGCGGTGCTCGAGTGCATGCGCACTAATAAATTGTATGCAAATACATCTAAGTGCATCTTTGGT
GCAGAAGAGATTCCCTTTCTGGGGTGCTTTATTGGGAAGCGAGGCCTTCGAGCGGACCCCGCTAAGGTAAGGGCCATAGTCGATTGGGCGGTTCCAAAGA
ACCAAAACGATTTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTATAGTGCGAATTACGCAGACATGACTCGGCCATTATCCAATCTCCTTAA
GAAGGATGTGGATTGTTGTTGGCGTAACACCGAACATGATGCTTTTCAAGCAGTTAAGGAAAGTCTCGTTCATGCGCCAATACTAGATTTGCCCGATCTT
GATCGGTCTTTCAGTGTTGTCTGTGACACATCTGACTTTGCCATAGGCAGTGCTCTGTTACAAAGAGATGTCGATGGACGCGAACGTGTCATTGCATTCG
AATCTCGACAGCTCAAAGCTGCTGAAAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCTATGAAGTACGCTCTAGTCAAATTCAGAGTACATAGCCG
TGCGGCTTATGCCAAGGATGAACAATGTGTAGCTTTGCTACTTGCTCTTGGGAGCGAGGAGTTTATAGACTCGGACATAGAATTGTCGGTACGTTTACGT
GAGAGGCTACATCGATATTCTATCAATAATGGCCTGTTGTGCTATCGCATATATATTGAGGATAACCCTCGTATCGCTGTCCCTCATGGTGAGGAGTTGA
AGTTTCGAATCCTCTATGAGTTACATGATACCGCTTTAAGTGGTCATCTCGGTCGTCAGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGGTGGCCCAA
AGTATACAAGTGGGTGAGCACCTATGTGCGTACGTGTGAAACGTGTCAACGGGATAAGCCCTCAGCACATGCGGCGGCGCCACCGGCTAGTCTGCCTGTA
CCCACTGGGTGTTGGTAGTCCATGAGTATGGACTTTGTGTTTGTCCTACCGAAAGATTCGGAAGGCAACACTGACATTGTGGTCTTTGTTGACCGATTAA
GTAAGATGGATCATCTAGCGGCAGTGCCGAACTCTATTGATGCCAAAGGCACAGCGAAGCTTTTTATCGACCGTGTGTTTCGACAACATGGTTTGCCAGT
GGCAATCGTCTCTGATAGAGATCCCTGATTCACTGGGAAGTTTTGGAAGTCCATCGTCAAGGTGCTCGGCACCCGTTTGGACATGTCCACAGCGGATCAT
CCGCAGACCGATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGACATTTTGCGCAGTGTTTGCGCTGATACGCCTAAGCGTTGGAGCTCCATGCTCC
CTGTTGTTGAATTTGCGTTGAACAACGCTGTTCATGCCTCTACAGGCTATATACTCCGTTCTACGTAAACGGTCTCACCCACCCTCGCGTTCCGTTAACG
CTACCACTATGTGGTTCAGGGCTTGGTGGGGGAGAGGTTGCCGATCGGCTTGCTGATATCAGCCCTGCTACTATGCAGAAACAAGTGAGCGAGTTTCTCG
CAACGCGATTGAATGTCTTAAGACATGTGCGTGACGCAATGGCTGAAAGCCAAGACCAACAAAAACAACAAGCAGATGCTAGAAACAGAGGCTGTATTGA
ACTTTATCAGGTCAGAGACCAAGTATTACTCAATGCTAAAAACCTACGTACAAATGTAGTGTCCACTGTCTTCAAGACAAAGTTGCGTCCGCGCTTCATT
GGACCATTCACGGTCGTTGCTAAGAAGGGTCTTGCGTATACGCTCAACCTTCCACGCAAATTGCGCACACATCCTTTGTTCTACGTTGGCTTACTTAAGC
CGTATTGAGATCC