Description :
From Genome Similarity Track
Location :
Scaffold_27:118426- 120479
Sequence
2053 bases(100 bases per row)
CTACGCTTGGTTTCACTATGGTCGAGTGTAGTGACGAATTACATTCCGCCGTTCGAAATAAAAGCCAGAGCCGTATTTATTTTCTGCCGCTGGCTCCGTC
GGTCCCGAAGGACAGCCCGACTTTCGCGTGACAAAAAGTCTAGAGCTTACGTGGTAGAATTCAGGTTTTGGTGCACGATTCGGTAGCTCTAGCAGTTGTG
ATGTTGAGAGATCATGCCTTCCTGCACCTCGAAAGCAACGTTTGGACGTGTGTTATTGATTGAAACTGCATGTGTATCTGGGGGTGCTAGAGGCTAAATG
CCAGCTAATGAGCAGTGTGTTGTGGGCAAACATTCGCCGGCGCATCGAAAACACTGTAAGTTGGCTTCGAGATTAGAAGTTACTAGCGCTTGCTGGTGAT
GGTTTCCGCCCCGAGGGCATCATGGGCGCAAGACTCACTTAGAGGTAAGGAGGTGATTGGTAGTGCTACAGTAATTTGCCTCAATAGCGCAATGGCTACA
TGTATACATTATTTAAGATAATTGCATAGGAGAGGCTAGCGGGACTCCCATTGGGTGGATTTGGGGTATAGACAGCTACCCGTTTCAGCAGGTTATTGGA
TGTCACGACTGCGCTATTGAGGCAAATTACTGTACTACAACAGGGTGATCTCCCCGCCATCAAGACGGATTTGCCAATAACTACACTGCCTACGGTAATT
AGTCTGTGTGCGGAAATAGTCTATGTTCGAAAATAGTCTTGGTCAGACTATTTATTGTACTGGTCAAAATGTAGAATTCATAATTAGTCGGACCACTTCA
ACTTCAAAATTAGTCTAGTCTTAGCAAAAATATAGTCTAGGTCAGACTATTTATTGTCTAAGAGCAATGAACCATTCGATCAAAAATAGTCTAGGTCAGA
CTAATTACCGTAGGCAGTGTAGCGCAACAACTTAGTCCATTTATATTGTGGTAGCTAGCAAAACGAGACGTTCATTAAGCAGTTAATCAACTTCTTCTTC
TTCAACAGGGTGATCCAGATGTTCCTTGAAGGTGAAGCGAGCGACATGGGAGGCTATCAATGACAGCGACATTAGAGCAAGCTTACAAGCCGAATGCTTG
CAGTGCACTCGGACAGCTTAGGCTATGATATCGTAGCCCAAGTAAGATGCGAGGCGTTCACAATGTACAGCAATCGACTGAGTGTACCAACATGTGGGGC
CTAACACGTACTACTGGTAGTACTTTTGCCACGCAGCTTTAGTAAGTCCCCACGCCACCTCCAGCGCCGTCGCCACCTGACCACAGTTCGACGGACGACA
CCATCGCCAAGGGTAAGTCGTGCCCGAAGGCCCTGCGCTACTATGCAGCAATACACGGCGAAACCACCAAGCTAGACCCGGAGGAGCGATGCCCACGTAC
AATGAGGAGGAGGTGGTGGTAGGGGGGGGGGGGGGGCAACGACCTCTTCGAGGTTGTCGTGCTGCGATCACAGCGGAAACATTGAGCGGCTACTTCATCA
CTGATGAATCATGAGCTTGCTCCCATGTGTACTGGGCGGTCGAAGCTACTGTAACAACTTGCCAAGTCAGGCATCAGCGAGCAGTAGATAGTCTAGCGTA
TACATTGCTTGAAGCTATGCTTTATTTAGCACCAGATGGACGAGATAAAGATTACTACTATAATACTATTAGTATTGCTACTGTAGTATTGCGTACATTT
TCTAAATGTAGATTGTACATAACAAAGCCGTGCTCTGCCCGGAACAGCTCTGGATTTTACGTTGCTCTTGGGCATATAAGGAGGAATTACTCCAGCTTGG
TAGCTCTTGTAAAAAGCTATGCAAGTACTTAGTAGTAGATTTGTAGCCATGAGTTATACTGATTTAAGCTACCACTATGCTACGCACCCCGCGCGGTCCT
CCGACCTTAAACGCTCGCTACGCTTACTTGGACAGATGCCAGGTTCAGGAGTAGAGCTTCAGTTTGGACAGCCCAGCCGGCCAAGGAAAATTTTTACTAC
GAGAGCTATGCGTAGGCTGGGATAGCTAAAGGATTTTGTGTGAGGTAATGCCA