Description :
From Genome Similarity Track
Location :
Scaffold_703:1184- 4086
Transcript NameFunction/comments
Physo_145243reverse transcriptase

Sequence
2902 bases(100 bases per row)
ACTGCCTGGTCCATGACCGAGGATGAGTTCAACTCGGCCGACGTGGACTCCGGTCGGAGGAGAACCAACTCTGCGATCTCCCCGGCCTTTAGCTCGGCCA
AGAAGTCCTCCATGGCGAGCTCCTCAAGGCTCAGCAACTCTGAAACCTCGGGCAGAGCTGTAAGCTCGACAGCTCCTGTCTTGACCCGACTACCGGTCAC
GCCGTCGAAGATGTGATAACACTCTTCGGCGGCTGGAGCCTTGGCTGGAGGCTCGGAGTCGCTGGCGACTGGCGTCGTCGGCAACACGACTTGGCCCGGC
TTACGACGTGACCCTCGGGTGTCTTCGTCTTGTGGCGCCGCCTTGACGGCACCACCGATCTTCTCGATCTCGTGCGGAACTACGTTACCCGCCTTGTCCT
TGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGTTGCGTGCGGGCAGGACCGACACGCAGACCGTCCATGAACACGGTCACCTTGATGTGTTCAGGCAGGGGGTTCC
CCACCAAAGAGGCAGTGAGCACTCGCATCTCCTGGATGTACTCATGCAGCTCGCGCCATCCTTGTTTGCAGGCGAGGAAGCGCGAACGCTGGCGGTACTC
GTAGTTCGCCGGATGAAACGCGGCCCGCAGCTGCTCGCACAGCTGGGACCATGATGCAAAGCATCCAGGCGTCGTCGATCGCGCGTATACGCCCAACTCT
TAGCGCGACCACTAAGGTTGGAGAGCGCAATGGCGACACGGAGTCGCTCGTCCGAGACGAGAGCCGCGTCCATCGCGAGCTCAACCTCTCGAACCCACAA
GTGAAGGTTTTCTCCTTCCTTCCCTTCGAAGGGGTGAACCTTCAGCCGCAGGGGCTTCGGTTGCACCGGCTTCGGCGCGGCCGCAGTGGCCTGCAGCCCT
TGAACGTGGGCGATGAGCCCTCGCTCGTAGGTGTCGAACGCGTTGATACGCTCAACCTGCTCAGCCGGCGTCGCCGCCGCTAAGCTACACAGGGCATCTG
TCCCAAAGATGCCTGCCATCTTACGAACGGACTCGTCCTGCGAGTCGTTCAGATGGGGAAACTCCGTACGATCCATCTTGGCTCACTCGATGAGACCACA
GAGGATTCAGGTAGTCCAATCTACCCGCGTAGGCGTAGGATTGACTACAAGTGCTACCAAGTGTGACGGGGCACACAGCACTTCTTAACAGAGGAAGCAG
AAGTATACAAACTCCAAGTGAACAGCCGTTCACGTGTCCCTGGTCTGAAGGGGACGACTTGACTTGAAAAGCGGTANGATCAAAGACTGAATGTATTTAT
AG