Description :
From Genome Similarity Track
Location :
Scaffold_343:1184- 2670
Sequence
1486 bases(100 bases per row)
TACTGTCGAGAGCCGTCCCGGAAGGGAGGGACAGTTAACACCGTATAGAAGTAGGAGCTAGCGATTGAGTAAACTTAAACAACAGAGTCAAATAAAAAGG
GTATTTAACTTGGTGTCTTCCGGGCAAAATCACAACTAACTGTTCTTACGCTACCAATCATTACGCTTCTCGCTTCACTGTCAATTCTTCCTTCGCAGAA
CCGCTCCTTCTAGCAGTCATCCGCACGCCAGCATCTCGGTCATCACTGCACACCACAACAGCACTTGCAACCAGACCAACTGTCCGCTCCACccgtcctc
gtcatccgcTTTCGCCTTAGCGGCCAGATCGCGACTGATCAGGCACTGCAAGTGCCACTGTTTCATACCCCCGATCCGGGCACTCATGGGTTCTGTTCCT
TATCAGCAACCTAGTATGGGTCGCGGCACCTCTCCCGTTTCGCAGGCGACTGGGCGTCCCGCTCATCTTCCCAGATCTGATCTTCAACCCCGCGAGAGGA
CGGTAGTCTCCGTGTCCGAGACGGTTGCCACCGCTATCACTCGGGACATTCTCCCCGACAGTATCTCGGCGTCCTCGCCGAGACGCAGCGATTTCCCAGT
CACACACCTTGGCCTGAAGCGCCCTTCTCCCAACTTGTAGTTCGCTCAGCGTGCGCACTAGCCCCCGCGCCGCTGGGTTGCCGTCTCCTTCTGCACTCCA
GAACGCTTCGTTACGCCACTCTATCCTGCTCTTGTTCTTCCATTGCCTGCAACCAGGCTCCATAATCGTCCTCGGTCATCCTCAACGGGGACCGTCCAAC
CAAAGTTAGAGCCACAGTTGGCTGACAACGCCGACCACAATCACCAGGCCGCTcgcagcggcgtcttccttgtcgaacacgacACCATCGACGTCCTTGA
TCCCTTCCTCATTCATGAAGTGATATTTTACAGTAACAGCAAGACGACCCCTCCAGGGCATCCTCGGCACGCCCGCTAAACAATTTCGTAAAGAATAGAA
CTCTGTAGAACACCGCGTAGATCAGGAGAGACACAACTGTCCCGATCACACGACCTGCAAGGCAAGCACGGTTGACCGTCCTCCAATGCTCGACCTTCAA
ACCGTCCAGTGCTTGACGGTTGAACGCCAACCGTACTTCCACGATTTTGGAAGAAACACGCACCAAACAAGCGTGGAATGCATCAATCCACTTGTTTATC
AGACGCCTTAAGCCTTCTAGGTGATCATGTCttgcctccagcaccaccattGGCGTAGCCCACAACGCGTCGTAGCCCTTCCACCATCTCTCACCACGGG
ACAGACCCTGAAGAGCAGGTCCGCGAACATACCCTCGATACCGACGAATACACGCTTTCGTAAGTCCAGTCCATTTGTACACGGTGTAGCTTAGCGCGGA
GAACAGACGGACCGCCACGGTACAGAGCGGTTGAGTGACTGCCCATACCAGAGCACCGGTCGTCAGCCACAGTAGTTCCCGCCAGT