Description :
From Genome Similarity Track
Location :
Scaffold_3514:1184- 2523
Sequence
1339 bases(100 bases per row)
CCCTTCCTCCTAATCCACCCTTCTCATGTGGATTCGTCTTCTCTTTTTTTCCGATGTGACCAACTCACATCAGAGGTCCTCCTCCTCCCGACCCACACCC
TTCCTGTGGGCCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGATCCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTG
TTCCGATTCGTACGATCCCGCAAGAAATCATAGAATAATGCTCCACCGCTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACA
CCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCGTGTTGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATT
CTAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTC
AGCTTGGATACGTGTACCACGGGGAACAAGCGATATTCGGTACCTGCCGTTTCCAACTTCACGGCGTGTTCCCCTATCTTTCACTTACTCTGAACGATCC
AAGCCAAAGATGGGCCAGTTTACGGGAATATCCTTCTTTCACTCGATCTAGGTACAGCCATACCTGCGATTCAACGTGGATTTGATGTGGACGGGCGTCT
TCGTTGTATCGATCCGCTCGATCTTGTATCGCACTCCGCAGCCGTTCGTTCACTTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATT
GTCTTGGATCTCGATTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGTGGATTTAGGATCCCACCCATGTATTAAGTAAGATGGAGTGTC
ACCCCAGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGGGGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAG
TGCCCTCGTGATCGTCTGTACCATGCGCTCGGCCGATACGTTAGCTTGGGAACAATATGCCATGGTTGCCCGCTGTCTCTGCCCCAGGATCCGGTTGAAA
GCTCGAAAGAAATCAGACATAAAGCCTGGCTCCTGATCATGCCTAATCATCTCACTAGCCCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCGGCAA
TGGTTGTGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGGTAGCAGATTCACCCAGATCAATAATTCTGTGTTTCCTTTGAACGACTTGGGC
AACGAGGGGGATGGTGATCCATGGCTATTGATTTGAAAG