Description :
From Genome Similarity Track
Location :
Scaffold_321:1184- 2310
Sequence
1126 bases(100 bases per row)
AAAAATCATTTTGGGATTTCTTCTTATAAGGCTATGTGGCTGGTGACGCGGTTATTATAGAGCAGGTCATCTGGGCGAGGATTGACAGAGATTAAACAAA
GCCGGGCATTGCAGATGTTCGAGGGGAACTTGCTTCCTACAGTTATGTTGATTCAGCTTTAGCGCATCCATCACGCACCATCCGTGGAGTACTGTATCTC
TACGACAACTGGGCATATCGATGTGGACGGGGTTGCTAACTAGTTTCTACAGtaagcgcagcagcatgcagtCAGTGACTGCCAGTCACACGGACACCAC
GGGGTTCCTGCAATGTACTGGACGCATTCTATCTGACGCTATCAATAAGGCTTTTGAGGCTGCAGCCTACGTTGGACATGTGGCGAATAATATTGTGTGG
GATAGAAAGGAATTTTCACTCGTGTTTTGGACTGCAAAGCGTTCGATGGCGATGGGGAGGATAGGTAGCACTATATTTATTCCACTGTCACCGATGAAGT
TGCCGTGGGCGAAGGAATGCGCAGATTATTCTGGTTATGAATGATCTAGATATTAACGCCGACATGTACTGCACATCAGAGACTGGATGCATTTTTTTGC
TGCCAACGGATTAGCAGGCAATGTCAGATTGTGAAAGCACCGGTACGGAAAGGCGAATCGCCGATTGAGAGCTGAACGGGAAAATCTATGGAGCTCGATC
TTGGGGAACTCGAGGTACCTATATTCAAAACTGGGTAAACCAAAAAGAGTATTACCAAACAGGGAACAATATTCCTTTTTTTGTGGATATTATCCATACA
GCATTCGCGATAATGGGCACTACCTCAGACCTAAGACACcaaagtttttttttcttctgaCTCATACGCTACACGTGTACCCTACCCTGCGCGCTCGGTT
GAGAATGATACAGAATTAATCTGACTGGTCAATGCGTCAATCAATATTAGCCGATAATAGACAACCTAGTGGTCCAGTCCACAACCAAAGCCCATTCCGA
AGCCCATTTCGAAGACGATCCAGCACAACAGGCCCCGCTGGCTCGCAACCTCGTGCCAGAGTTCGCGAGGGTGGCACTCGCTCCGCCAGTGTTATCGTCA
AACGCATCCCCCTTTGTCATCACCCA