Description :
From Genome Similarity Track
Location :
Scaffold_1:1183950- 1185827
Transcript NameFunction/comments
g372.t1ETO58721.1 hypothetical protein F444_22899, partial [Phytophthora parasitica P1976

Sequence
1877 bases(100 bases per row)
CCAACGACTCTCGCAGTCGTTGGCGTTCGCTTTGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGATGGAGGGCCGCATACACCACGTGGTGCAT
GTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGAGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGGTCATGCCGTGC
AAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCGAGGACGATAAGTTCGTCGACGAACTCCTTCTCTTGGTAAGAGAAGCGTACGCGT
ACGATACGCTTCTCGGTTCTAACAACGACAACCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGC
TCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTT
GTCATCTTGCTTCTTGCAGTGAGATCGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCAGCACCAGCAGGG
CGCCCCGCGTCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGGCGATACCCAGTATCGCCACGACGGCTTCTCGCCGCGTGCACAGGTGCTGTGCACTC
GCGGGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCTGTCGCACTCGAGAGGTCCATT
GGTTCGGGACTTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTG
CAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGGAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGT
CGGCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACTGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAAC
TCCGCCCTCAATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTC
GGCGTCCATACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGAGACGTCGAGCCGTAATGGCAGT
GTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTACCAACGTAGCTGCTTACGTGGAGTTTTAATGACTCCACGCGCGGTGTGGCCGATGGC
GACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCTTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTG
CTACCGCCGCTTCCCAAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGCAGTCTGCACGCGCAACATGCGTTGCAGAC
GTGTTTGGGCTACCCACGGATATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTCTTTATCGGTCGTTGGACGGA
CTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAAGTTACTTAA
GTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGAAAGCTTTGGTGGTAAATGAGA