Description :
From Genome Similarity Track
Location :
contig_45:118366- 119385
Transcript NameFunction/comments
g8049.t1hypothetical protein PHYSODRAFT_358530

Sequence
1019 bases(100 bases per row)
AATGACCGTGCTGAACGCGGTCGTGGTAGCTTCTCCTACAACGACTCTGGTCGCGACCGAGATCGCGATCGTAGCCGCGATCGTGACCGCTATAACCGCA
GTGACAGAGGAGGTGACTATGACCGCCGCGACCGGGGATACGGTGCTTCTTCGGATAGAGAAAGATATCGCCGAGACGACAGAGATCGTGGAGACAGGAG
TCCAAAGCGGCCGCGCGTACAGCAGTGCCGTAAATGCCGTCGTGCGAAGTCTGCGTGCCAGTGCAGCTTTCGTGGTCGTTAGCTGAGCTGCTAACTCGAA
CTAACCGTCAAGATTCGAGGTAGAAGAATAGTCGGCAGAGCGCAGGGGCTTGATGGTTCAAGTCGGTAGAGACCTAAGCTTGCAGCTAGTTACGATACAC
TTCTGCCATGAACGAGCTATGAATACACGCTGTACGCTTGTTCAAACCACTGGCACAGCCCAATAGTTGCTTCGAGCTTGAATGTTGCAGCTTCGTGTGG
CTTGTGACCAGACCAGCGGCTTTTGTCGAGGCCAGCACCACGCGAACGTAGGGCGGTAAATGTTCAACACGTCCACGAAAGTTCGCTGGTATTCATGTTC
TGTACTACATCCACAGCTTCTGCCCCCGCACCAACTCTCAAAGTACGCTCAATTTGTGATTCTCAGATGTGCATGTATCCATTGCAATAGTCTGCTCTAG
GCGACCCAAGCGATCGCCAACTCTGGAAATGAACCCGGGCAAGAAATACGATACAAGCGAAGTCATCTCCATCAGCAGACGCAAGTAAAAGAGACCCGAA
CGAGATTCTCAGATCCGCGTCGAACCTCGAGCTGAACGAAAGTATCAGTACGAAGAAATAGATTGATGTATTACCTTGTTGCGCTATACGAATACGAATG
CTTGCAAGTCCCCAACCAAGACATGACATTGTCGTCTCGAGCAGGTGAATTTTGGGCTATTATTTTTGTCTTGGAACTGCCGCCATGCCGTTCACTCTTG
TTCGCCAGCTCAATCTCCG