Description :
From Genome Similarity Track
Location :
contig_82:118344- 121281
Transcript NameFunction/comments
g12093.t1hypothetical protein
g12094.t1hypothetical protein

Sequence
2937 bases(100 bases per row)
GGAAAATGGTCCAGAAGCCGTTCCCAAGCAACCGTGACAAGCATCGCTACGACACGTTCGAGCTGCTCCACTTCGACATCTGCGGCCCCATGGAAGAAGA
GTCTCTGGGTGGCAGCAAGTATCTGCTGCTGATCGTGGACGAAGCCAGCGGATGCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAAGACTGC
ATCAAGACGTACGTCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACGCGCTGAAGG
CCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGAT
CGGCCGCAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAG
GTGGAGCACAAGACTCCATTCGAGATCGTGTACAAGTCCAAGCCAAGTGTCAAGCACATGCGTGTGTTCGGATGCCAGACGTACATCCTGACGCCGAAGG
AAAAGCGGCGCAAGTGGGACCCCAAGGCTCGCGCCGGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGAGGCGGGGCA
GGTGGTTGTCAGTCGCGATGTCAACTTCGATGAGTCGGCCTTTGGACTTTCGGCGCATACTTCGGATGAAGACGTCGATGATGCTGCGCTGGACCTGGAC
GCGCTGGACCTGGACGACAACGATGGACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCGCAAGAACCGACCGAGTGGCGACGACGACACTGCCAGAA
GATCGCGCCCCGTTCGCCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTCCTCCTCGCGCCGAGCTGAACCCGACGAAGAAGAAAAGTCTGGGG
ACCAAGATGAAGACGACGACCCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCTATCGGAGCCGACGACGTTCCA
AGAGGCTGTGAACGGTCCGGATCAGGTGCACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATGCGACTGCGTGGTGTGTTTCGAGCTGCCAAGTTG
CCCAGCGGCCAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGG
GCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGACGCTGCGCATGATCATCGCGATCGCCAAGTACTTCGG
CTGGCCCCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGTCATGAAGGGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGGTGG
GTTCGACTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACGTTCGACGAGTTCATGTGCTCTATCGGCTTC
CAAGTGTCGGCCTTCGATCCGTGCCTCTACATCAAGGTGGTGGACGGTCACTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTT
CGCCCGAGCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGTAGA
CGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGGGACGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTCCGGTGG
ACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGATGACCGCCACGCG
CCCGGACATCGCGTACGCCGTTGGCTATGTGTCGCGTTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAA
GGCCCAAGACGCATGCATCTGCTCAACCGGGCGACCAATCGACTTTCGTGGCTACTCGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTT
CAGCTACACGTTCATGCTGATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGTGTGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTC
AGCCTGGCTATCCAAGAAGGCAAGTGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCACGAGACGGGACCCGAGCTCATGATCCGCGAAGACAA
CCAGTCGTGCATCAAGATGACCAAGAAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACACAAGTACCACCACATCCGCGACGAAGTGAAACGCGGT
GAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACCAAGGCACTTGCGGACCACGCCACACGGAGCTGACGGCGGCTCTCGG
CATTCATGGGACTTCGCATTGAGGGGGCGTATTGAGGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTCC
AATCCGAACCCACGCCGATTACGCCACCGACGATTACGCCACTGTCGATTACGCTACCTGTGGGTACAAGATTGTAGACAAGATGGGCTTCGACGTGGCG
CTCTCTCATTGGCTGAAGTAACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTC
AATCAATCACTTTCGAATCTTCGTTCTACCCCTCAAG