Description :
From Genome Similarity Track
Location :
Scaffold_275:11832- 12857
Transcript NameFunction/comments
Phyag_g4198hypothetical protein PHYSODRAFT_351217

Sequence
1025 bases(100 bases per row)
CCTcaatgaggaggagaacaagaaggaccaGTTCCCCGTGCTCGcgaaggagcgcaaggagatcaaggagcagctggacgagaagttcaccaagctcaag
gccCTCCGTaaggagttcaaggaggCCAACGACAAGTACTACAACAACATCCGCCTTGTGCGCAAAaagaaggagctcgagcgccagaaggaggaggagg
cccgCAAGGCCGAGTACGAGGCCAAGCTGGCTGActacgagaaggagatggccaagATCCACCCGTAccaggacgagatggaccTGTGCGACGCCCttgt
cagcttcttggagaagacgtacgccaaggagctcaaggaggaGGGCGAGAAGGCGgctgagactgctgctgcccccgTTGAGCTGGATGGCATGAAGCCT
CTGCAgcgcaaggaggaggacttCATGATGCTTGGAGGtggcaagaagagcaagaagggTCGCCAGggcaagaagtccaagaaggctGCCAAGCTCGTCC
TGCCGCTCGCGCAGATGGAGGCTTTCAGCACCATCGGCCTGCTGCCGCCTGCTTCTGCTGGCGTTGTCTCGGAGTCGCTGACTGCcgtcaaggccaagaa
gatctGGTTCAACGAGCAGACGTCGCGCCCCAAGGCCGACAAGCCCGCTGAGGCAGCTGCTGAGACCGCCGCTGCTCCAGCCAAGGCGGCTtcccccaag
aagaagagcaacaagaacaagaagttcAACGCCGGCGACAATGACGCGTTCCCGTCGCTTGGCGGCGTGGCTGCCGAGCTTCCTTCGTGGGGCCCGGGCA
TGGCTCCTCCCGCTTCCGCTGAGCCCGCTGTGGCGGCTGAATTCGCTGATGCCGACGTCATTACGGAGGACGAGTAAGTCTCCTCATAAGGAGAGAGTCT
GCTCAGCAATGATCACCTCTggacacgcagcagcacggaaTCAAGCACGCTTAAAAGGGACTGGAGGCGCTCGCTCGCTACCAAGGAAGAGCTTGTGGCG
TCTCTCGCCTTTTACTCTAGCGTGT