Description :
From Genome Similarity Track
Location :
contig_82:118295- 121232
Transcript NameFunction/comments
g10258.t1hypothetical protein

Sequence
2937 bases(100 bases per row)
TGTCAGCAAGGGAAAATGGTCCAGAAGCCGTTCCCAAGCAACCGTGACAAGCATCGCTACGACACGTTCGAGCTGCTCCACTTCGACATCTGCGGCCCAT
GGAAGAAGAGTCTCTGGGTGGCAGCAAGTATCTGCTGCTGATCGTGGACGAAGCCAGCGGATGCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGC
GAAGACTGCATCAAGACGTACGTCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACG
CGCTGAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCAT
CGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCG
TCACCCAAGGTGGAGCACAAGACTCCATTCGAGATCGTGTACAAGTCCAAGCCAAGTGTCAAGCACATGCGTGTGTTCGGATGCCAGACGTACATCCTGA
CGCCGAAGGAAAAGCGGCGCAAGTGGGACCCCAAGGCTCGCGCCGGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGA
GGCGGGGCAGGTGGTTGTCAGTCGCGATGTCAACTTCGATGAGTCGGCCTTTGGACTTTCGGCGCATACTTCGGATGAAGACGTCGATGATGCTGCGCTG
GACCTGGACGCGCTGGACCTGGACGACAACGATGGACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCGCAAGAACCGACCGAGTGGCGACGACGACA
CTGCCAGAAGATCGCGCCCCGTTCGCCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTCCTCCTCGCGCCGAGCTGAACCCGACGAAGAAGAAA
AGTCTGGGGACCAAGATGAAGACGACGACCCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCTATCGGAGCCGAC
GACGTTCCAAGAGGCTGTGAACGGTCCGGATCAGGTGCACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATGCGACTGCGTGGTGTGTTTCGAGCT
GCCAAGTTGCCCAGCGGCCAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCG
TGGCCAAGGGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGACGCTGCGCATGATCATCGCGATCGCCAA
GTACTTCGGCTGGCCCCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGTCATGAAGGGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACT
GGATGGTGGGTTCGACTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACGTTCGACGAGTTCATGTGCTCT
ATCGGCTTCCAAGTGTCGGCCTTCGATCCGTGCCTCTACATCAAGGTGGTGGACGGTCACTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTA
CCGGGAGTTCGCCCGAGCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGA
GCTGGTAGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGGGACGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGA
GTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGATGAC
CGCCACGCGCCCGGACATCGCGTACGCCGTTGGCTATGTGTCGCGTTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGC
TACCTGCAAGGCCCAAGACGCATGCATCTGCTCAACCGGGCGACCAATCGACTTTCGTGGCTACTCGACGCGGACTGGGCCGGCGACCTCGCGGACCGCA
AGTCCACTTCAGCTACACGTTCATGCTGATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGTGTGTCGCTGTCCACGAGCGAAGCGGAGTAC
ATCGCGCTCAGCCTGGCTATCCAAGAAGGCAAGTGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCACGAGACGGGACCCGAGCTCATGATCCG
CGAAGACAACCAGTCGTGCATCAAGATGACCAAGAAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACACAAGTACCACCACATCCGCGACGAAGTG
AAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACCAAGGCACTTGCGGACCACGCCACACGGAGCTGACGGC
GGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGGCGTATTGAGGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCG
AACCGGTCCAATCCGAACCCACGCCGATTACGCCACCGACGATTACGCCACTGTCGATTACGCTACCTGTGGGTACAAGATTGTAGACAAGATGGGCTTC
GACGTGGCGCTCTCTCATTGGCTGAAGTAACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCT
AAAGACCTCAATCAATCACTTTCGAATCTTCGTTCTA